Qpcr core kit forsybrgreen

Real-time PCR was performed using a Step One Plus real-time PCR machine (Applied Biosystems). All reactions were performed using the qPCR^TM core kit forSybrGreen® (Applied Biosystems). Real-time PCR on test samples was carried out in triplicate using appropriate forward and reverse primers for Bmp7Forward: TGGTCATGAGCTTCGTCAAC; Reverse: CCTCTGGGATTCTGGAGAGA), Chrdl1(Forward: GTGTGCTCTGTCTCCTGCTC; Reverse: AAGCCCGTAGGGTTCTAGGT) and Twisted Gastrulation (Forward:CAAGCAACAACATCCACGCA; Reverse:GCACTCTGGCCCAATACACT). For TaqMan assays, total RNA was also reverse-transcribed using SuperScript®III first strand synthesis kit (Invitrogen). Quantitative real-time PCR was performed on cDNA samples and no template controls using custom designed fluorogenic TaqMan probes (Integrated DNA Technologies (IDT), Inc.) and brilliant III fast QPCR mastermix (Agilent). Amplification of target genes was detected using the Step One Plusreal-time PCR machine (Applied Biosystems). Inter-sample variation was corrected for by normalizing gene expression levels to internal levels of the “housekeeping gene” large ribosomal protein (RPLPO)reference (Forward: GTCACATCACAGGGAGCAAT; Reverse: GCTTTGTGTTCACCAAGGAG).