DNA encoding aa 403-1390 of ATAD2 was PCR amplified from the full-length codon-optimized synthetic ATAD2 gene (Genscript), and subcloned into an in-house modified pFastBac1 vector with an N-terminal 3xFlag tag and Tev protease cleavage site using EcoRI and XhoI restriction sites. Point mutants of ATAD2 (E532Q, D415A, and R540A) were created by inverse PCR with KOD plus polymerase (Toyobo) according to product manual instructions. Cloned plasmids were transformed into DH10Bac competent cells to produce bacmids that were subsequently transfected into SF9 cells to produce baculovirus, and baculovirus was amplified to P3 according the Bac-to-Bac Baclulovirus Expression Kit (Thermo Fisher Scientific). ATAD2 proteins were expressed by infecting 950 mL of SF9 cells at a density of 2.5–3.5 ×106 with 50 mL of P3 virus for 45-48 h. Recombinant X. laevis histones H3 and H4 were overexpressed in E. coli and purified by inclusion body purification as described by Luger et al50 (link).
Kod plus polymerase
Manufactured by Toyobo
Sourced in Japan
KOD plus polymerase is a high-fidelity DNA polymerase used for PCR amplification. It exhibits superior processivity and accuracy compared to conventional DNA polymerases.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Rna pcr kit ver 3, by Takara Bio (2 mentions)
Mmessage mmachine sp6 kit, by Thermo Fisher Scientific (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Omniscript reverse transcriptase kit, by Qiagen (2 mentions)
Rnase free dnase 1, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Gateway system, by Thermo Fisher Scientific (2 mentions)
Gateway topo cloning kit, by Thermo Fisher Scientific (2 mentions)
Pretrox tre3g retroviral plasmid, by Takara Bio (2 mentions)
Lipofectamine rnaimax, by Thermo Fisher Scientific (2 mentions)
Pjet1.2 vector, by Thermo Fisher Scientific (2 mentions)
Kod fx neo polymerase, by Toyobo (1 mentions)
Kod fx neo buffer, by Toyobo (1 mentions)
Kod plus neo polymerase, by Toyobo (1 mentions)
Dneasy blood and tissue kit, by Qiagen (1 mentions)
Abi prism 3730 sequencer, by Thermo Fisher Scientific (1 mentions)
Abi prism bigdye terminator cycle sequencing kit, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Rneasy plant mini kit, by Qiagen (1 mentions)
48 protocols using kod plus polymerase
1
Overexpression and Purification of ATAD2
2
Optimized PCR Amplification Conditions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oligonucleotide primers used in this study are listed in Additional file 3 : Table S3. The reaction mixture consisted of 5 μl of 2 × KOD FX neo buffer (Toyobo, Osaka, Japan), 2 μl of 2 mM dNTPs, 0.2 μl of KOD FX neo polymerase (Toyobo), and 0.3 μl each of the primer pair (10 μΜ) in a total volume of 10 μl with sterile water. Cycling conditions were as follows: 94°C for 2 min, followed by 30 cycles each of 98°C for 10 s, 65°C for 30 s, and 68°C for 3–4 min. For construction of pKM152, KOD plus polymerase (Toyobo) was used. This reaction mixture consisted of 1 μl of 10 × KOD plus buffer, 1 μl of 2 mM dNTPs, 0.4 μl of 25 mM MgSO4, 0.2 μl of KOD plus polymerase, and 0.3 μl each of the primer pair (10 μΜ) in a total volume of 10 μl with sterile water. Cycling conditions were as follows: 94°C for 1 min, followed by 30 cycles each of 94°C for 20 s, 60 or 65°C for 30 s, and 68°C for 1–4 min. The amplified DNA fragments were directly used for yeast transformation.
3
Genetic Manipulations in Streptomyces
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
General genetic manipulations in E. coli, including DNA isolation, enzyme digestion/ligation and DNA transformation, were conducted according to previous descriptions [22 ].
Genomic DNAs were isolated from Streptomyces using 2 mg mL-1 lysozyme to remove the cell wall [19 ]. Amplification of Streptomyces genes with high (G+C) % by PCR was performed using KOD-Plus polymerase (Toyobo). Protoplast transformation and intergeneric conjugation for introduction of DNA into Streptomyces hosts were carried out according to standard protocols [19 ].
Genomic DNAs were isolated from Streptomyces using 2 mg mL-1 lysozyme to remove the cell wall [19 ]. Amplification of Streptomyces genes with high (G+C) % by PCR was performed using KOD-Plus polymerase (Toyobo). Protoplast transformation and intergeneric conjugation for introduction of DNA into Streptomyces hosts were carried out according to standard protocols [19 ].
4
Molecular Characterization of Respiratory Adenoviruses
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Throat swabs or nasopharyngeal aspirations were placed in virus transport medium and submitted to the virus diagnostic laboratory as soon as they were obtained, year-round. Viral cultures of laboratory-confirmed adenoviruses were processed as described previously.8 (link) The adenoviruses were subcultured in A549 cells when 85% cytopathic effect was observed. The cells were then harvested for DNA extraction.
Viral DNA was extracted according to a modified procedure as previously described.9 (link) DNA sequencing of hexon and fiber genes of respiratory adenovirus was carried out as previously described.7 (link) Briefly, the Loop1 region of the hexon gene was amplified with primer pair HXL1F (5′-CGTGTGCAGTTYGCCCG) and HXL1R (5′-ACAGCCTGATTCCACAT). The Loop2 region of the hexon gene was amplified with primer BL (5′-TTGACTTGCAGGACAGAAA) and BR (5′-CTTGTATGTGGAAAGGCAC). PCR mixtures consisted of 1U of DNA polymerase (KOD Plus Polymerase, Toyobo), 1 mM MgSO4, 0.2 mM dNTP, 300 pm of each primer, and 1 to 2 μL of template from the original purified DNA solution in a 50-μL reaction volume. DNA sequencing analysis of PCR products was performed using Sanger method.
Viral DNA was extracted according to a modified procedure as previously described.9 (link) DNA sequencing of hexon and fiber genes of respiratory adenovirus was carried out as previously described.7 (link) Briefly, the Loop1 region of the hexon gene was amplified with primer pair HXL1F (5′-CGTGTGCAGTTYGCCCG) and HXL1R (5′-ACAGCCTGATTCCACAT). The Loop2 region of the hexon gene was amplified with primer BL (5′-TTGACTTGCAGGACAGAAA) and BR (5′-CTTGTATGTGGAAAGGCAC). PCR mixtures consisted of 1U of DNA polymerase (KOD Plus Polymerase, Toyobo), 1 mM MgSO4, 0.2 mM dNTP, 300 pm of each primer, and 1 to 2 μL of template from the original purified DNA solution in a 50-μL reaction volume. DNA sequencing analysis of PCR products was performed using Sanger method.
5
Transient overexpression of olNbs1-Venus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sequence of olNbs1 was amplified from first strand complementary DNA of Hd-rR embryos by using KOD-plus- polymerase (TOYOBO, Osaka, Japan) and primers designed based on the Hd-rR sequence of olNbs1 (NBS_shinF_xho1, CCGCTCGAGCCCGCTGTTTACATTTCTCG , NBS_shinR_linkerXho1, CCGCTCGAGACCTCCACCTCCCCTGAAC ). The olNbs1 sequence was then subcloned into XhoI site of pG-olphsp70.1-hRluc-Venus, which enables transient and induced overexpression of olNbs1-Venus protein by heat induction at 41°C for 2 h [43 (link)]. To generate Q170H nonsynonymous mutation (CAG to CAT) the following primers were used, F.olNbs1_Q170H (CAACAGTGCTGTCCATCAAAAACGTCCGCC ), and R.olNbs1_Q170H (GGCGGACGTTTTTGATGGACAGCACTGTTG ). Overlapping PCR was conducted with KOD-plus-neo polymerase (TOYOBO), followed by digestion of the wild-type plasmid with DpnI. Then, the amplicon was introduced into an XL10-Gold competent cell (Stratagene, Agilent Technologies, Santan Clara, CA, USA). The plasmid was verified by sequencing.
6
Medaka RNA Isolation and mRNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were isolated using TRIzol (Life Technologies) and were converted to cDNA using the RNA-PCR kit ver.3 (Takara Bio, Japan) followed by PCR using KOD plus polymerase (Toyobo, Japan). For mRNA production, PCR amplified full-length cDNAs (medaka YAP, 70KDaFN1a,b, ARHGAP18) were cloned into pCS2+ and for in situ hybrization medaka sox3 cDNA was cloned into pBluescript II SK(−). pCS2+myr-ARHGAP18 was constructed by adding the myristoylation sequence using oligonucleotides to produce myristoylated ARHGAP18 mRNA. mRNAs were synthesized using SP6 mMESSAGE mMACHINE Kit (Ambion, USA). Primer sequences are shown in Supplementary Table 5 .
7
Generation and Genotyping of Apert Syndrome Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All animal experiments were performed in accordance with the protocols approved by the Institutional Animal Care and Use Committee of Tokyo Medical and Dental University (Permission number: 0110009B). All samples were extracted from mouse embryos at embryonic day 15.5 (E15.5). All efforts were made to minimize animal suffering. AS mice (Fgfr2+/S252W mice) were generated by mating male Fgfr2+/Neo–S252W mice and female +/Ella-Cre mice. Polymerase chain reaction (PCR) genotyping of progeny mice was performed using tail genomic DNA isolated with a DNeasy Blood and Tissue Kit (Qiagen, Crawley, UK), KOD Plus Polymerase (Toyobo, Osaka, Japan). The following specific primers were used for the PCR: 5′-TAGGTAGTCCATAACTCGG-3′ and 5′-TTGATCCACTGGATGTGGGGC-3′ . While single fragments were amplified from the genomic DNA of Fgfr2+/Neo–S252W mice (457 bp) and +/EIIa-Cre mice (393 bp), both 457-bp and 393-bp fragments were amplified from that of AS Fgfr2+/S252W mice. Littermates were used as controls.
8
RNA Extraction and cDNA Synthesis for OfAbd-A and OfUbx Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from fifth-instar larvae using Trizol Reagent (Invitrogen, Carlsbad, USA) and was treated with RNase-free DNase I (Ambion, Austin, TX, USA), according to the manufacturer’s protocol. cDNA was synthesized with Omniscript reverse transcriptase kit (Qiagen, Hilden, Germany), using manufacturer’s instructions. Putative OfAbd-A and OfUbx genes were identified using the NCBI Blast system. OfAbd-A cDNA fragments were amplified by PCR with the following pair of primers: forward, 5′-ATGGCAGCGGCTGCCCAGTT-3′; and reverse, 5′-TTACGTGGGGACTTTGTTCA-3′. OfUbx cDNA fragments were amplified by PCR with the following pair of primers: forward, 5′-ATGAACTCCTACTTTGAGCAGGGT-3′; and reverse, 5′-TTACGTGGGGACTTTGTTCA -3′. PCR was carried out using KOD -Plus- polymerase (TOYOBO, Osaka, Japan) under the following conditions: 98 °C for 2 min, followed by 30 cycles at 98 °C for 30 s, 55 °C for 30 s, 68 °C for 1 min, and an elongation phase at 68 °C for 10 min. Amplified products were sequenced after cloning into a PJET1.2-T vector (Fermentas, Burlington, ON, Canada). The primers are listed in Table S1 .
9
Bovine Chemerin Gene Sequence Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
According to the sequence of the bovine chemerin gene (GenBank accession no. NM_001046020), two pairs of primers were designed to amplify a coding region of the chemerin gene that included exons 2 to 4. The gene primer sequences were: E1-forward: 5′-GGCTGGGCTAAGGAACAGTG-3′, E1-reverse:5′-GGTCTCCAACCTCAGGCTTC-3′. E2-forward: 5′-CTGCAGGATAGTTCTGACTTTTG-3′, E2-reverse: 5′-GCTTTATTAGCTCAGGGGTCA-3′. Polymerase chain reaction (PCR) amplifications were performed in 30-μL reaction mixtures, each containing 10 to 30 ng DNA template, 5 μM of each primer, 3 μL 10×PCR Buffer for KOD-Plus-, 0.20 mM dNTPs, 1.67 mM MgSO4, and 0.5 U KOD-Plus- Polymerase (Toyobo, Osaka, Japan). The PCR protocol was 94°C for 9 min followed by 35 cycles of 30 s at 94°C, 30 s at 63°C or 60°C, and 1 min at 72°C and a final extension at 72°C for 5 min. Next, the PCR products were electrophoresed through 1.5% agarose gel and single band was confirmed. Then, the products were purified using Fast Gel/PCR Extraction Kit (Nippon Genetics Co, Ltd, Tokyo, Japan). Finally, the PCR products were sequenced to detect the presence of SNPs. Bi-directional DNA sequencing of PCR amplicons was carried out using an ABI PRISM 3730 sequencer (Applied Biosystems, Foster, CA, USA). Sequencing variants were detected by visual examination of the sequencing map followed by alignment using CLUSTAL (Higgins and Sharp, 1988 (link)).
10
Site-directed Mutagenesis of bchB Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nucleotide substitutions causing amino acid change were introduced into bchB region of pHANB142 (link) using two primers, BchBHis378Ala-f1 (5′-ggtgatAtcggcgcccgtcGCG gtgcaggacttccccgcccg-3′) and BchBHis378Ala-r1 (5′-cgggcggggaagtcctgcacCGC gacgggcgccgaTatcacc-3′). The changed nucleotides are shown in upper case and the codons corresponding to the amino acid residues to be changed are capitalised and underlined. To easily confirm the introduction of the mutations, another silent mutation besides the targeted codon was introduced to create a new restriction site (EcoRV). PCR reactions were performed with KOD-plus polymerase (Toyobo, Osaka, Japan). The nucleotide sequences of mutagenised bchB were confirmed by DNA sequencing.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!