Exome sequencing was performed to assess for mutations in the DNA binding domain of p53 in the lung tumors and lymphomas. Genomic DNA was purified from formalin-fixed, paraffin-embedded lymphomas and lung tumors using the QIAamp DNA FFPE Tissue Kit (QIAGEN). PCR amplification of exon 4 was performed using the forward primer 5′-CTACATAGCAAGTTGGAGGCCAG-3′ and reverse primer 5′-AAGAGGCATTGAAAGGTCACACG-3′. Exons 5 and 6 were amplified using the forward primer 5′-GGAGGAAGAAGGAAAGGTCCCAG-3′ and reverse primer 5′-ACCGGACTCAGCGTCTCTATTTC-3′. Amplicons were purified using the QIAquick PCR Purification Kit (QIAGEN) and sequenced at the Duke University DNA Analysis Facility using the same primers used for PCR amplification. Sequencing results were analyzed for mutations using CLC Sequence Viewer (CLC bio).
Clc sequence viewer
Manufactured by Qiagen
Sourced in Denmark, Germany, United States, United Kingdom
The CLC Sequence Viewer is a software tool for viewing and analyzing DNA and RNA sequence data. It provides basic functionalities for visualizing and manipulating sequence information.
Automatically generated - may contain errors
Lab products found in correlation
Abi3130xla genetic analyzer, by Thermo Fisher Scientific (3 mentions)
Topo ta cloning kit, by Thermo Fisher Scientific (2 mentions)
Bigdye terminator v3, by Thermo Fisher Scientific (2 mentions)
Clustal omega, by Qiagen (2 mentions)
Bigdye terminator v 3.1 chemistry, by Thermo Fisher Scientific (2 mentions)
Qiaquick pcr purification kit, by Qiagen (1 mentions)
Qiaamp dna ffpe tissue kit, by Qiagen (1 mentions)
Epitect bisulfite kit, by Qiagen (1 mentions)
Genejet plasmid miniprep kit, by Thermo Fisher Scientific (1 mentions)
Qiaamp dna micro kit, by Qiagen (1 mentions)
Takara epitaq hs kit, by Takara Bio (1 mentions)
3730xl dna analyzer, by Thermo Fisher Scientific (1 mentions)
Applied biosystems 3130xl genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Clonejet pcr cloning kit, by Thermo Fisher Scientific (1 mentions)
Pfu polymerase, by Thermo Fisher Scientific (1 mentions)
Bigdye terminator v3.1 cycle sequencing, by Thermo Fisher Scientific (1 mentions)
Abi prism 3100 genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Chromas, by Technelysium (1 mentions)
Hiseq 2500, by Illumina (1 mentions)
Rneasy plus kit, by Qiagen (1 mentions)
43 protocols using clc sequence viewer
1
Exome Sequencing of p53 in Lung Tumors
2
Neuronal DNA Methylation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from primary neuronal culture 4 weeks after glutamate treatment using the QIAamp DNA Micro Kit (Qiagen, Hilden, Germany), followed by bisulfite conversion of 1 μg of genomic DNA using the EpiTect Bisulfite Kit (Qiagen) according to the manufacturer’s protocol. Regions of interest were amplified using the TaKaRa EpiTaq HS Kit (TaKaRa Clontech, Otsu, Japan) and cloned using the TOPO TA Cloning Kit (Life technologies) doing blue/white screening. White colonies were selected and grown in LB medium overnight. The plasmid was purified using the GeneJET Plasmid Miniprep Kit (Thermo Scientific, Darmstadt, Germany) and clones were sequenced by Sanger sequencing (GATC Biotech, Cologne, Germany). Sequences were quality controlled and aligned using the CLC sequence viewer (CLC bio) and Quantitation tool for Methylation Analysis software (RIKEN). Primers used to amplify bisulfite converted DNA are summarized in Table 3 .
Bisulfite primers used for DNA methylation analysis
| PrimerID | Forward primer | Reverse primer |
|---|---|---|
| Gria2 BB1 | TTAGTTGGGTTAGGTGAGGTA | TCCCATACACTCACACAATCA |
| Gria2 BB2 | TATAGAGAGATAAAGATAGAGAGAT | AATAAATTACCTCATTACATCAAAC |
| Grin2a BB1 | AGGTATTGAGAGGAGTATTTTGG | CCACCACACCAACTTAAAACT |
| Grin2a BB2 | AGTGAGTGATAAAAGTAGTTAGTG | ATCTCTTCCTAACCTTACCTTAT |
3
Sequence and Phylogenetic Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sequence identification and analysis were done using CLC sequence viewer (CLC bio), BLAST and Clustal Ω [62 (link)]. Phylogenetic analysis were conducted using MEGA version 6.06 [63 (link)]. Statistical analyses were done in SigmaPlot v. 13 by one way analysis of variance using the Holm-Sidak method.
4
Screening shRNA Library for FRET Targets
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Illumina sequencing reads were sorted by bar codes, trimmed down in silico to the 27-bp antisense shRNA sequence (CLC sequence viewer; CLC Bio) and aligned to the human genome hg_17 database (47 (link)). The number of reads for each individual shRNA in a data set was normalized to the total number of reads in that respective data set (unsorted, FRET+, or FRET−). Any shRNAs that showed a total number of reads that represented less than 0.001% of both the unsorted and FRET+ data sets were discarded for each experiment. FRET+/unsorted and FRET+/FRET− ratios were calculated by dividing the normalized number of reads from the respective data sets for each shRNA. For each experiment, the median and the median absolute deviation (MAD) were calculated for both the FRET+/unsorted and FRET+/FRET− ratios. MAD was calculated as Mediani (|Xi − Medianj(Xj)|), in which Medianj is the median of all the deviations and Xj is the deviation of the sample. From these values, ZMAD was calculated for each shRNA in which ZMAD = (X − median)/MAD (22 (link)). Any shRNA with a ZMAD of >2 for both the FRET+/unsorted and FRET+/FRET− ratio was classified as a potential hit in the screen and was a candidate for further analysis.
5
Core Genome Identification in Komagataeibacter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The clusters of orthologous proteins in the analyzed genomes were generated using Proteinortho program (v. 5.11; Lechner et al., 2011 ). When it was necessary, gene presence was verified using the NCBI BLAST program (version 2.2.26; Altschul, Gish, Miller, Myers, & Lipman, 1990 ; Camacho et al., 2009 ). The core genome set was built by finding clusters of genes, which had an ortholog in every Komagataeibacter genome (G. diazotrophicus PAl 5 was not included). Genomes of K. kakiaceti JCM 25156 and K. intermedius TF2, were excluded from this list due to low genome quality. Hierarchical clustering and heatmap plotting was done using R (v. 3.1.0) and gplots package (release 2.17.0). CLC Sequence Viewer (v. 7.8.1) was used to generate and visualize multiple sequence alignments. SnapGene Viewer (v. 3.3.4) was used to display structure of gene clusters.
6
Primer Design and Validation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The CLC Sequence Viewer (CLC Bio), Primer Plex (Premier Biosoft), and Primer-BLAST (NCBI) programs were used to design primers specific for the viral and cellular gene sequences of interest. These primers allowed the amplification of a unique product of the expected size, as determined by melt curve analyses. All primers were validated to confirm an amplification efficiency of 100% ± 10%, as calculated by the linear regression obtained from standard curve assays. The primers used to quantify viral and cellular mRNAs are shown in Table 1
7
DNA Sequencing and Mutation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Purified DNA and purified PCR products were sequenced using an Applied Biosystems 3130xl Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) or 3730xl DNA Analyzer (Applied Biosystems) using BigDye Terminator v3.1 (Applied Biosystems). Sequencing results were analyzed using the CLC sequence viewer (Version 7.0; CLC Bio, Waltham, MA, USA). For mutation analysis, direct sequencing of the PCR products was performed twice.
8
Phylogenetic Analysis of Parvovirus B19 Genotypes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sequences were aligned using CLC Sequence Viewer (version 8.1.1 Aarhus, Denmark) and the phylogenetic tree was generated using the neighbor-joining algorithm based on the Kimura two-parameter distance estimation method as previously described [15 (link),48 (link)]. Bootstrapping and reconstruction were carried out with 1000 replicates to obtain the confidence level of the phylogenetic tree. For the NS1-VP1u gene nucleotide sequence homology comparison, sequences were compared with reference sequences representing the three main B19V genotypes from the GenBank database: Genotype 1A: PVBAUA prototype (M13178.1), Wi strain (M24682) [11 (link),49 (link)], NC_000883, DQ225150, DQ225151, DQ408301, Z68146, DQ225149, AF162273, and AY504945; Genotype 1B: DQ357065 and DQ357064 [14 (link)]; Genotype 2: Lali prototype (AY044266) and A6 strain (AY064475) [10 (link),50 (link)]; Genotype 3: V9 strain (AX003421) and D91.1 strain (AY083234) [51 (link)].
9
Phylogenetic Analysis of DNA Gyrase and Topoisomerase IV
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Amino acid sequences of proteins were aligned with ClustalW 2.1 using the default parameters [39 (link)]. The percentages of sequence identities were calculated by dividing the number of identical residues by the total aligned sequence length without insertions. Aligned sequences were viewed using CLC Sequence Viewer (CLC bio). Aligned amino acid sequences of gyrase and topoisomerase IV proteins from various species were inputted into MEGA (v. 6.06 beta) [38 (link)]. Pairwise distances between sequences were computed (the number of amino acid differences divided by the total number of amino acids compared). Gaps and missing data were deleted and no variance estimation method was used. A maximum parsimony tree was calculated using the Jones-Taylor-Thornton model assuming uniform rates among sites. Phylogeny was tested using the bootstrap method with 500 bootstrap replications.
10
Alu Sequence Identification and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sequencing data were analyzed by using the CLC Sequence Viewer (CLC Bio) and the ClustalW2 programs. Identified Alu sequences were arranged into subfamilies according to Repbase (http://www.girinst.org/repbase/) program. In order to identify the genomic origin of identified Alu elements, sequences were analyzed with BLAT (UCSC Genome Browser) algorithm and further confirmed with the ENSEMBL Genome Browser.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!