Rt2 easy first strand kit

C2C12 cells were seeded in a 6-well plate at a density of 1 × 10⁴ for 24 h. The next day, cells were treated with the papaya extract (200 μg/mL) or the vehicle control (DMSO) in 500 μL of glucose-free D, MEM for 24 h. The Glut 4 expression in C2C12 cells was determined using a quantitative real-time polymerase chain reaction (RT-PCR). Total RNA was extracted from C2C12 cells using the RNeasy mini kit (Qiagen, Germantown, MD, USA). The concentration of the RNA was determined by NanoDrop 2000 (ThermoFisher, Washington DC, USA). First-strand cDNA was synthesized from total RNA using the RT2 Easy first strand kit (Qiagen, Germantown, MD, USA). Glut-4 mRNA expression levels were analyzed via real-time PCR (QuantStudio 3, Applied Biosystems instrument, Waltham, MA, USA) under the following reaction conditions: initial denaturation at 95 °C for 5 m, followed by 40 cycles of denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s, and lastly elongation at 72 °C for 30 s. The relative gene expression was quantified using the 2^−ΔΔCt method [31 (link)]. Glut-4 expression levels were normalized against GAPDH. The sequence of the primers employed in this study was as follows: forward primer: 5′GAGCCTGAATGCTAATGGAG3′ and reverse: 5′ GAGAGAGAGCGTCCAATGTC3′ for Glut 4; forward primer: 5′ TGAGTACGTCGTGGAGTCCA3′ and reverse primer: 5′ TAGACTCCACGACATACTCA3′ for GAPDH.

Colon tissue was emptied from all fecal matter, washed in sterile PBS and immediately stored in RNAlater (Qiagen, Germany). RNA was extracted from the tissue using the RNeasy kit (Qiagen, Germany) according to the manufacturer’s instructions. RNA quality was verified with the Agilent Bioanalyzer system using RNA micro chips (Agilent Technologies, USA). Using 400 ng RNA, cDNA was prepared using the RT2 Easy First Strand Kit (Qiagen) following manufacture`s protocol.
To measure expression level of 12 genes (Reg3g, S100a8, Cxcl9, Ncr1 (NKp46), Cxcl1, Ifng, Cx3cl1, Il17a, Ccl22, Nos2 (iNOS), Bcl6, Foxp3) a custom made plate was used (Qiagen). RT² SYBR Green Master Mix (87.5 μL, 2x, Qiagen), cDNA (13.7 μL) and nuclease-free water (73.8 μL, Qiagen) were mixed and 10 μl added to each well. Plates were run on QuantStudio 7 Flex Real-Time PCR System (ThermoFisher, USA) according to manufacturer’s protocol. Fluorescence was measured for each cycle. Ct values for each gene were subtracted from the mean Ct value of the housekeeping genes to normalize (Actb). The upper CT limit was fixed to 35 cycles.

U‐118 MG cells treated with miR218 mimic were collected for total RNA isolation with ExtractME Total RNA Kit (Blirt) according to the manufacturer’s protocol. 900 ng of RNA was used in the reverse transcription procedure with RT² Easy First Strand Kit (Qiagen). cDNA mixed with the RT² SYBR Green was then evenly aliquoted onto the RT² profiler plates: Human Cell Motility, and Human Extracellular Matrix and Adhesion Molecules (Qiagen). qRT‐PCRs were conducted in LightCycler®480 (Roche), and subsequently analysed by software provided online by Qiagen.

The following chemicals were
purchased from Merck S.A. (an affiliate of Merck KGaA, Darmstadt,
Germany): paraformaldehyde, acrylamide, anti-rabbit IgG-HRP conjugate,
bovine serum albumin (BSA), bicinchoninic acid disodium salt hydrate,
sodium dodecyl sulfate (SDS), Tris, ethanol, HPLC grade methanol,
sodium carbonate, sodium hydrogen phosphate, sodium dihydrogen phosphate
goat anti-rabbit IgG-HRP conjugate (ab97051), goat anti-mouse IgG
HRP conjugate (ab97023), antiamyloid beta precursor protein (ab32136),
anti-RANTES antibody (ab189841), anti-MAG antibody (ab46803), anti-MBP
antibody (ab53294), anti-MMP9 antibody (ab38898), anti-myelin PLP
antibody (ab28486), and anti-TNF-α antibody (ab1793) were from
Abcam (Abcam PLC, Cambridge, UK). RNeasy lipid tissue mini kit, RT2
easy first strand kit, and mouse multiple sclerosis RT² profiler PCR array were bought from Qiagen (CA, USA). Maxima SYBR
Green qPCR master mix (2×) was purchased from Thermo-Fermentas.
Hooke kit MOG_35–55/complete Freund’s adjuvant
(CFA) emulsion PTX (cat. no. EK-2110) was purchased from Hooke Laboratories,
Inc. (Lawrence, MA, USA). All other chemicals and solvents were obtained
from commercial sources at the highest grade of purity available.

Right ventricular tissues were homogenized in Qiazol (Qiagen, Germantown, MD, USA) using handheld homogenizers (Kinematica, avantor, Radnor, PA, USA). This was immediately followed by RNA isolation using Qiagen RNeasy Mini Kit as per the manufacturer’s instructions (Qiagen, Germantown, MD, USA). Isolated RNAs were then used for cDNA synthesis and genomic DNA elimination using RT² Easy First Strand Kit (Qiagen) per manufacturer’s instructions.

RNA was extracted from T4-4 cells seeded on DPP coated plates at 4 and 24 h time points. The samples were then subjected to genomic DNA contamination removal using elimination mixture (Qiagen), and first strand cDNA synthesis was carried out using the RT² Easy First Strand Kit (Qiagen) as described by the manufacturer's protocol. PCR array analysis was performed on the predesigned Focal Adhesion Profiler™ array of 96 genes (Super Array Bioscience Corporation). RT-qPCR was performed on ABI Step One Plus machine. For data analysis, the ΔΔCt method was used; for each gene fold-changes were calculated as difference in gene expression between untreated controls and treated cell cultures. The result from the array was interpreted using software provided by Qiagen.