Luminaris color higreen qpcr master mix

Expression of candidate genes of interest (fatty acyl desaturases 5 and 6 and fatty acyl elongases 2, 5a and 5b) was determined by quantitative PCR (qPCR) in liver of fish from all treatments (S1 Table). Results were normalised using reference genes, elongation factor 1-α (ef1a) and cofilin-2 (cfl2), chosen as the most stable according to GeNorm. Primers were designed using Primer 3 [34 (link)] in regions that included the microarray probes. qPCR was performed using a Biometra TOptical Thermocycler (Analytik Jena, Goettingen, Germany) in 96-well plates in duplicate 20 μl reaction volumes containing 10 μl of Luminaris Color HiGreen qPCR Master Mix (Thermo Scientific), 1 μl of the primer corresponding to the analysed gene (10 pmol), 3 μl of molecular biology grade water and 5 μl of cDNA, with the exception of the reference genes, which were determined using 2 μl of cDNA. In addition, amplifications were carried out with a systematic negative control (NTC-no template control) containing no cDNA. Standard amplification parameters contained an UDG pre-treatment at 50°C for 2 min, an initial activation step at 95°C for 10 min, followed by 35 cycles: 15 s at 95°C, 30 s at the annealing Tm and 30 s at 72°C.

For the determination of gene expression levels, total RNA was extracted using a Direct-zol™ RNA MiniPrep kit (Zymo Research, Irvine, CA, USA) according to the protocol provided by the manufacturer. Total RNA was reversed transcribed using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems™, Thermo Fisher, Waltham, MA, USA). The resulting cDNA was amplified by qRT-PCR using Luminaris Color HiGreen qPCR master mix (ThermoFisher Scientific, Waltham, MA) in a StepOnePlus™ Real-Time PCR System (ThermoFisher, Waltham, MA, USA) using standard procedures. Table 1 shows the sequences of each primer used in this study. The expression levels of target genes were normalized by β-actin mRNA levels.

For analyzing gene expression, cells were isolated with TRIzol reagent (Thermo Fisher Scientific, Carlsbad, CA, USA). RNA isolation, cDNA synthesis, and quantitative PCR were performed as previously described [33 (link),34 (link),80 (link)]. Briefly, 1-bromo-3-chloro-propane (Sigma-Aldrich, St. Louis, MO, USA) and centrifugation were used for the separation of RNA. Cleaning of RNA was performed with an RNA Clean & Concentrator-5 kit (Zymo research, Freiburg, Germany). The quality and quantity of the RNA were measured with Nanodrop OneC (Thermo Fisher Scientific, Carlsbad, CA, USA). SuperScript IV Reverse Transcriptase (Thermo Fisher Scientific, Carlsbad, CA, USA) and Oligo(dt)18 primers (Thermo Fisher Scientific, Carlsbad, CA, USA) were used for cDNA synthesis. Quantitative PCR was performed with Luminaris Color HiGreen qPCR Master Mix (Thermo Fisher Scientific, Carlsbad, CA, USA) according to the manufacturer’s protocol and analyzed with qTOWER3 (Analytik Jena, Jena, Germany). Primer design was performed as previously described [33 (link),34 (link),80 (link)]. The quality and specificity of the primers were analyzed using melting curves and agarose gel electrophoresis. Dilution series of cDNA were used to calculate primer efficiency. Table 1 contains all information on the used primers. RPL22 and TBP were used as reference genes for data analysis according to the ∆∆CT method.

qPCR was performed using cDNA isolated from the material used for transcriptomic analysis and the following pair of oligonucleotides (5′-TCAGGTGTACTCGCCCTAAA-3′) and (5′- GCGAACCACTGTTCCTCATT-3′) as the forward and reverse primers, respectively, in a PikoRealTM Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA) with Luminaris Color HiGreen qPCR Master Mix (Thermo Fisher Scientific). The primers are complementary to the coding region of NBR1. Actin 2 (At3g18780) was selected as a constitutively expressed gene to normalize the quantity of total RNA present in each sample. Relative gene expression levels were calculated using the delta-delta Ct method [25 (link)]. The qPCR was carried in 3 biological replicates (each in 3 technical replicates to assess operator variance).

BM DCs were collected at day 6, treated with dZym (10 µg/mL), and then harvested at the indicated time points. The total RNAs were extracted with TRIzol reagent (Invitrogen) and converted to cDNA by Revert Aid First Strand cDNA Synthesis Kits (Thermo Fisher Scientific) according to the manufacturer’s instructions. SYBR Green real-time PCR was performed with Luminaris Color HiGreen qPCR master mix (Thermo Fisher Scientific) by PikoReal System (Thermo Fisher Scientific). The primers for CCR7 (forward: 5′-AGA GGC TCA AGA CCA TGA CGG A-3′; reverse: 5′-TCC AGG ACT TGG CTT CGC TGT A-3′) and GAPDH (forward: 5′-GAC AAC TTT GGC ATT GTG G-3′; reverse: 5′-ATG CAG GGA TGA TGT TCT G-3′) were used. All mRNA levels of CCR7 were normalized with GAPDH and the fold-change represented the CCR7 expression of dZym-treated BMDCs compared to that of untreated cells.

Viroid infection in the inoculated plants was verified by dot-blot hybridization with a PSTVd-specific digoxigenin-labeled RNA probe (DIG RNA labeling mix, Roche Diagnostics, Mannheim, Germany). Selected plant samples were additionally subjected to RT-qPCR analysis. One microgram of purified total RNA was reverse transcribed with a specific primer complementary to the CCR region (nucleotide positions in PSTVd-S23: 78–94) using the Omniscript RT Kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer’s instructions. Real-time PCR was carried out in a PikoReal Real-Time PCR System (Thermo Scientific, Vilnius, Lithuania) using Luminaris Color HiGreen qPCR Master Mix (Thermo Scientific, Vilnius, Lithuania) and two specific primers, (i) CTTTCTTCGGGTGTCCTTCC and (ii) CTCGGGAGCTTCAGTTGTTTC, which were used previously by [53 (link)]. The cycling parameters were as follows: 1 cycle at 95 °C for 10 min, and 40 cycles each consisting of 15 s at 95 °C, 30 s at 59 °C and 30 s at 72 °C. Linearized plasmid encoding PSTVd-S23 was used to generate a standard curve. Data analysis was carried out by PikoReal™ Software 2.2.