Log In Sign up
The largest database of trusted experimental protocols

Chromatin immunoprecipitation chip assay kit

Manufactured by Merck Group
Visit Supplier
Sourced in United States, Germany, United Kingdom

The Chromatin Immunoprecipitation (ChIP) Assay Kit is a laboratory tool used to investigate protein-DNA interactions within a cell. The kit provides the necessary reagents and protocols to perform chromatin immunoprecipitation, a technique that allows researchers to identify specific DNA sequences associated with a particular protein of interest.

Automatically generated - may contain errors

Lab products found in correlation

Control rabbit antibody for igg, by Cell Signaling Technology (4 mentions) Polyclonal antibodies for yap, by Cell Signaling Technology (3 mentions) Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions) Anti p stat3, by Cell Signaling Technology (2 mentions) Normal rabbit igg ac, by Santa Cruz Biotechnology (2 mentions) Sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions) Ne per nuclear and cytoplasmic extraction reagent, by Thermo Fisher Scientific (2 mentions) Ez vision dna dye, by Avantor (1 mentions) Rna polymerase 2, by Abcam (1 mentions) Recombinant human resistin, by Thermo Fisher Scientific (1 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions) Trizol reagent, by Takara Bio (1 mentions) Dual luciferase assay kit, by Promega (1 mentions) Re chip it kit, by Active Motif (1 mentions) Ab175932, by Abcam (1 mentions) Ab4729, by Abcam (1 mentions) Ab1791, by Abcam (1 mentions) Bioruptor ucd 300, by Diagenode (1 mentions) Gel extraction kit, by Omega Bio-Tek (1 mentions) Sds lysis buffer, by Beyotime (1 mentions)

47 protocols using chromatin immunoprecipitation chip assay kit

1

Profiling H3K27ac Enrichment at SOCS2 Locus

Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP was performed in human AML cell lines using Chromatin Immunoprecipitation (ChIP) Assay Kit (Millipore, 17-295). Experiments was carried out according to the manufacturer's instructions. Three sets of qPCR primers were designed against the H3K27ac-enriched SOCS2 locus, according to the UCSC database. Primer sequences were as follows: SOCS2_F1, 5′-GTT CAG TTA GCT CCG CCC AC-3′ and SOCS2_R1, 5′-GGG GGC ATT TCC CAG CTA AC-3′; SOCS2_F2, 5′-AGG ACC TGA TCA AGG GGA CC-3′ and SOCS2_R2, 5′-GAC TGT GGG TCC TCG GAA AC-3′; SOCS2_F3, 5′-TCT CTG CCA CCA TTT CGG AC-3′ and SOCS2_R3, 5′-CGC AGG GTC ATG AGA GAA GG-3′.
Jin X., Ng V., Zhao M., Liu L., Higashimoto T., Lee Z.H., Chung J., Chen V., Ney G., Kandarpa M., Talpaz M, & Li Q. (2022). Epigenetic downregulation of Socs2 contributes to mutant N-Ras-mediated hematopoietic dysregulation. Disease Models & Mechanisms, 15(5), dmm049088.
+ Open protocol
+ Expand
2

ChIP-qPCR Analysis of CTCF Binding

Check if the same lab product or an alternative is used in the 5 most similar protocols
Frontal Cortical tissue from rats was collected and used for chromatin immunoprecipitation assay by Chromatin Immunoprecipitation (ChIP) assay kit (Millipore, MA, USA) according to the manufacturer's instruction. Briefly, tissue was disaggregated and incubated in 1% formaldehyde (cross-link). Chromatin was sheared by sonication. Samples were incubated with anti-CTCF antibody (1:1000, Millipore, Cat# 07-729, RRID: AB_441965) or with an equivalent amount of normal IgG (anti-mouse). A portion of the sonicated DNA was left untreated to serve as input control. Immunoprecipitated DNA was subjected to quantitative realtime PCR using primers specific to the rat Bdnf exon IV & VI. The cumulative fluorescence for each amplicon was normalized to input amplification.
Tyagi E., Zhuang Y., Agrawal R., Ying Z, & Gomez-Pinilla F. (2014). Interactive actions of Bdnf methylation and cell metabolism for building neural resilience under the influence of diet. Neurobiology of disease, 73, 307-318.
+ Open protocol
+ Expand
3

ChIP Assay for Activin A Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols
The ChIP procedure was carried out according to the manufacturer’s suggestion [Chromatin Immunoprecipitation (ChIP) Assay Kit; Millipore, Darmstadt, Germany]. The pull-down DNA was amplified for detection with either EGFR forward and reverse primers (primer sequences in the luciferase assay section) or exon 19 primers27 (link) by real-time PCR (Stratagene Mx3005P). The PCR products were finally separated on a 2% agarose gel with EZ-Vision DNA Dye (AMRESCO, USA). ChIP real-time PCR was quantified via the fold enrichment method (antibody signal over IgG secondary antibody control) to obtain ΔCt (Ct of IP Ab- Ct of IgG Ab). ΔΔCt was calculated as ΔCt (treatment; rActivin A or inhibitor treatment) – ΔCt (control or DMSO), and then the relative fold of enrichment was calculated as 2−ΔΔCt. OC3 cells were serum-starved for 24 hr before rActivin A (10 ng/ml) treatment. OC3 cells treated with DMSO alone were considered onefold, and the relative fold for each treatment was normalized to the level of the DMSO-treated OC3 group.
Tsai C.N., Tsai C.L., Yi J.S., Kao H.K., Huang Y., Wang C.I., Lee Y.S, & Chang K.P. (2019). Activin A regulates the epidermal growth factor receptor promoter by activating the PI3K/SP1 pathway in oral squamous cell carcinoma cells. Scientific Reports, 9, 5197.
+ Open protocol
+ Expand
4

ChIP Assay on Xenopus Tadpole Intestine

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP assay on Xenopus tropicalis tadpole intestines was done as described previously (40 (link)) with an antibody against TR (anti-TR) (38 (link)), RNA Polymerase II (abcam, Cambridge, MA), or methylated histone H3K79 (anti-H3K79m2, abcam, Cambridge, MA), and with IgG as a negative control, by using Chromatin Immunoprecipitation (ChIP) Assay kit (Millipore, Burlington, MA). Each sample had three replicas and each replica included at least 5 tadpoles. The immunoprecipitated DNA was analyzed by qPCR with SYBR Green PCR Master Mix on a StepOne Plus Real-Time PCR System (Applied Biosystems, Foster City, CA). For the analysis of MBD3 TRE, primers 5’-ATGCCCGCCTACTCTTTATTCCTCCAGCTGC-3’ (forward) and 5’-GAGAGAGAGTCAGTGTGGTGGTGGGTCAGA-3’ (reverse) were used. All ChIP experiments were done twice with similar results.
Fu L., Li C., Na W, & Shi Y.B. (2020). Thyroid hormone activates Xenopus MBD3 gene via an intronic TRE in vivo. Frontiers in bioscience (Landmark edition), 25, 437-451.
+ Open protocol
+ Expand
5

ChIP-qPCR Analysis of DNMT Promoters

Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP was performed using anti-pSTAT3 (Cell Signaling, Danvers, MA) and the Chromatin Immunoprecipitation (ChIP) Assay Kit (Millipore, Burlington, MA) according to the manufacturer’s instructions. Normal rabbit IgG-AC (Santa Cruz Biotechnology, Dallas, TX) was used as negative control for the antibody. The immunoprecipitated genomic DNA was amplified by qPCR using 3 pairs of PCR primers (Table S1) covering the region of the DNMT1 and DNMT3b promoter regions.
Ibrahim M.L., Klement J.D., Lu C., Redd P.S., Xiao W., Yang D., Browning D.D., Savage N.M., Buckhaults P.J., Morse HC I.I.I, & Liu K. (2018). Myeloid-Derived Suppressor Cells Produce IL-10 to Elicit DNMT3b-Dependent IRF8 Silencing to Promote Colitis-Associated Colon Tumorigenesis. Cell reports, 25(11), 3036-3046.e6.
+ Open protocol
+ Expand
6

Resistin-Mediated NF-κB Activation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
TRIzol reagent was purchased from Takara (Dalian, China), and LipofectamineTM 2000 was obtained from Invitrogen (Carlsbad, CA, USA). The antibody against the NF-κB p65 subunit was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Recombinant human resistin was purchased from PeproTech, Inc. (Rocky Hill, NJ, USA). The glucose assay kit was purchased from Applygen Technologies Co., Ltd. (Beijing, China). Small interfering RNAs (siRNAs) were synthesized by IBS Bio (Shanghai, China). The Dual-Luciferase Assay kit was purchased from Promega (Madison, WI, USA). The Chromatin Immunoprecipitation (ChIP) Assay kit was from Millipore (Burlington, MA, USA).
Wen F., Xia Q., Zhang H., Shia H., Rajesh A., Wu Y., Yang Y, & Yang Z. (2020). Resistin Activates p65 Pathway and Reduces Glycogen Content through Keratin 8. International Journal of Endocrinology, 2020, 9767926.
+ Open protocol
+ Expand
7

ChIP-Based Quantification of Transcriptional Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
The cells were cross-linked with 1% (v/v) methanol-free formaldehyde for 10 min (histone modification) or 20 min (chromatin modifiers) and processed according to the protocol described in Chromatin Immunoprecipitation (ChIP) Assay Kit (Millipore). Re-ChIP assays were performed using Re-ChIP-IT kit (Active motif) with specific antibodies. Antibody-chromatin complexes were pulled-down using magnetic protein G beads (Cell Signaling Technology), washed and then eluted. After cross-link reversal and proteinase K treatment, immunoprecipitated DNA was extracted with phenol-chloroform, ethanol precipitated. ChIP primers were as follows:
mIL-6pro(0-0.5K)-F: cctgcgtttaaataacatcagctttagctt, R: gcacaatgtgacgtcgtttagcatcgaa; mTNFpro(0-0.5K)-F: ccagccagcagaagctccctcagcgag, R: gcggatcatgcttt ctgtgctca tggtgtc; hIL-6pro(0-0.5K)-F: acttcgtgcatgacttcagc, R: agtgcagcttaggtcgtcat; mRsad2pro(0-0.5K)-F: tcttggctctggtccaactt, R: actgtgtcacaaggaggagg; mCmpk 2pro(0-0.5K)-F: ggaattctcaagagcaggcg, R: taggaaattctggccctggg; mIfit2pro (0-0.5K)-F: accgtctctctcccaattcc, R: ctgtgtcctgctattgtcgc.
Zhang Q., Zhao K., Shen Q., Han Y., Gu Y., Li X., Zhao D., Liu Y., Wang C., Zhang X., Su X., Liu J., Ge W., Levine R.L., Li N, & Cao X. (2015). Tet2 is required to resolve inflammation by recruiting Hdac2 to specifically repress IL-6. Nature, 525(7569), 389-393.
+ Open protocol
+ Expand
8

Chromatin Isolation and ChIP-qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
For S2 cells, after RNAi treatment and hormone (ecdysone) incubation when indicated, bulk chromatin was isolated using the Chromatin Immunoprecipitation (ChIP) Assay kit according to standard manufacturers protocols (Millipore Sigma). For whole animals, larvae of the appropriate genotype were collected and bulk chromatin was prepared according to the methods described in (45 (link)). Triplicates from at least three independent biological replicates were analyzed using the 2−ΔΔCt method. Data is expressed as fold enrichment relative to input sample or percentage of input chromatin. IgG was used as a negative control. Primers used for ChIP-qPCR are provided in Supplementary Table S1.
Zraly C.B., Zakkar A., Perez J.H., Ng J., White K.P., Slattery M, & Dingwall A.K. (2020). The Drosophila MLR COMPASS complex is essential for programming cis-regulatory information and maintaining epigenetic memory during development. Nucleic Acids Research, 48(7), 3476-3495.
+ Open protocol
+ Expand
9

ChIP-qPCR Analysis of H3K27ac and NRF1 Binding

Check if the same lab product or an alternative is used in the 5 most similar protocols
L02, HepG2 and Hep3B cells were crosslinked with 1% formaldehyde at room temperature for 10 min, followed by neutralization with glycine for 5 min and lysis with SDS lysis buffer (Beyotime, China). The crosslinked DNA was fragmented into 100–1000 bp fragments using Bioruptor UCD-300 (Diagenode, Belgium). Chromatin immunoprecipitation was performed using the Chromatin Immunoprecipitation (ChIP) Assay Kit (Millipore, USA). Sonicated cell lysate was subjected to immunoprecipitation with anti-H3K27ac (ab4729, abcam, USA), anti-NRF1 (ab175932, abcam, USA), anti-histone H3 (ab1791, abcam, USA) and anti-IgG (3900 S, Cell Signaling Technology, Switzerland). Immunoprecipitated DNA was purified using the Gel Extraction Kit (Omega Bio-tek, USA) and subjected to quantification by qRT-PCR. Primer sequences were provided in Table 2.

Primer sequences for ChIP-qPCR.

GeneSE regionPrimer sequence (5’-3’)
RHOBSE1ForwardGCACAAGACTCCCTCCCTTC
ReverseAGGTTCCTCCAACCCTGAGA
SE2ForwardCCAGTCTGAGGGAAGCACAG
ReverseCCTCAGTTCCACACTTCGCT
SE3ForwardACCAAGGGAGACCAGGTTGT
ReverseGTGACCCCACACCAACGATT
SPIDRSE1ForwardCACAGACACTGCTTTGGTGC
ReverseCACAGCACTGGGACTTTTGC
SE2ForwardACTCCAGAAACTGGGCATCG
ReverseAGGCACAGCCCCTAGTGATA
SE3ForwardTGCGCATTTGTCTGGTAGGT
ReverseTCTTGAGCTAAGGCTTGGGC
SE4ForwardGATACACGTAGCAGCCGTGA
ReverseTTCTCCCGAAGAACGCAGAC
Liu B., Dou J, & Cao J. (2024). Nuclear respiratory factor 1 regulates super enhancer-controlled SPIDR to protect hepatocellular carcinoma cells from oxidative stress. BMC Gastroenterology, 24, 97.
+ Open protocol
+ Expand
10

Cytokine Signaling Inhibitor Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
RPMI-1640 medium, penicillin and streptomycin, SB203580 (p38MAP Kinase inhibitor), SN50 (NF-κB inhibitor) were from Sigma (St. Louis, MO, USA). dNTPs, Revert Aid M-MuLV Reverse Transcriptase, oligo dT, RNase inhibitor and others for cDNA synthesis were from Fermentas (Ontario, Canada). Phospho-H3 and acetyl-H3 Abs were from Abcam (Cambridge, UK) and chromatin immunoprecipitation (ChIP) assay kit was from Millipore (Bedford, MA). TLR2, MyD88, IRAK 1, NF-κB, p38, phospho-p38, ERK1/2, phospho-ERK1/2, T-bet, β-Actin antibodies were from Santa Cruz Biotechnology (Texas, USA). Ara-LAM was isolated as previously described [20 (link)]. Lipopolysaccharide contamination (<25 ng/mg) was checked by the Limulus test. All antibodies for FACS were from BD Biosciences (San Diego, USA).
Bandyopadhyay S., Kar Mahapatra S., Paul Chowdhury B., Kumar Jha M., Das S., Halder K., Bhattacharyya Majumdar S., Saha B, & Majumdar S. (2015). Toll-Like Receptor 2 Targeted Rectification of Impaired CD8+ T Cell Functions in Experimental Leishmania donovani Infection Reinstates Host Protection. PLoS ONE, 10(11), e0142800.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!