Mircury lna universal rt microrna pcr system

Manufactured by Qiagen

Sourced in Denmark, United States, Italy

The MiRCURY LNA™ Universal RT microRNA PCR system is a comprehensive solution for the detection and quantification of microRNA expression. It includes a reverse transcription (RT) step and a subsequent real-time PCR amplification step, enabling sensitive and specific measurement of microRNA levels.

Automatically generated - may contain errors

Lab products found in correlation

Universal cdna synthesis kit 2, by Qiagen (7 mentions) Exilent sybr green master mix, by Qiagen (5 mentions) Lightcycler 480, by Roche (5 mentions) Lightcycler 480 real time pcr system, by Roche (4 mentions) Trizol reagent, by Thermo Fisher Scientific (4 mentions) Mircury rna isolation kit, by Qiagen (4 mentions) Mircury lna universal rt cdna synthesis kit, by Qiagen (3 mentions) Quantifast sybr green pcr kit, by Qiagen (3 mentions) Universal cdna synthesis kit, by Qiagen (3 mentions) 7900ht thermocycler, by Thermo Fisher Scientific (3 mentions) Trifast, by Avantor (2 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions) Calnexin, by Santa Cruz Biotechnology (2 mentions) Abca1, by Novus Biologicals (2 mentions) Gapdh, by Santa Cruz Biotechnology (2 mentions) Steponeplus thermocycler, by Thermo Fisher Scientific (2 mentions) Rnaseout, by Thermo Fisher Scientific (2 mentions) Protein g sepharose bead, by GE Healthcare (2 mentions) Protease inhibitor cocktail, by Roche (2 mentions) Hsa mir 122 5p lna pcr primer set, by Qiagen (2 mentions)

Spelling variants of this product

MiRCURY LNATM Universal RT microRNA PCR system (6 citations) LNA miRCuRY (2 citations)

64 protocols using mircury lna universal rt microrna pcr system

Plasma microRNA Isolation and Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA from previously collected plasma samples was isolated using miRCURY RNA Isolation Kit Biofluids (Exiqon) according to the manufacturer’s instructions. The RNA spike-in controls (Exiqon) were used according to the manufacturer’s instruction for validation of RNA isolation (UNiSp2, UNiSp4 and UNiSp5), cDNA synthesis and PCR amplification (UniSp6, cel-miR-39-3p). Moreover, an additional template-free control was purified by the samples and profiled. Briefly, EDTA-plasma samples were thawed on melting ice and centrifuged to avoid presence of cell debris. Next, debris-free samples were lysed using lysing solution and RNA isolation was performed. Isolated RNA was reverse-transcribed using a miRCURY LNA Universal RT cDNA Synthesis kit (Exiqon). The cDNA was diluted 50× and assayed according to the protocol for the miRCURY LNA Universal RT microRNA PCR system (Exiqon). All LNA primers were obtained from Exiqon. The Step-One Plus system was used for amplification (Applied Biosystems). All data were normalized to the cel-miR-39-3p control.
Results were derived by the (2^–^Δ^CT) × 10⁴ (miR-1) or (2^–^Δ^CT) × 10² (miR-126) and normalized to the volume and to the expression of cel-miR-39-p3.

Kazimierczyk E., Eljaszewicz A., Kazimierczyk R., Tynecka M., Zembko P., Tarasiuk E., Kaminski K., Sobkowicz B., Moniuszko M, & Tycinska A. (2020). Altered microRNA dynamics in acute coronary syndrome. Postępy w Kardiologii Interwencyjnej = Advances in Interventional Cardiology, 16(3), 287-293.

+ Open protocol

+ Expand

Quantitative Analysis of miRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The expression level of specific miRNAs was determined using the miRCURY LNA™ Universal RT microRNA PCR system and ExiLENT SYBR^® Green master mix (Exiqon). Quantitative RT-PCR were performed in triplicate on a LightCycler 480 Real-Time PCR System (Roche). The expression of miR-146b-5p was normalized using the 2^−ΔΔCq method relative to the expression of miR-484 (hsa-miR-484 Product no.: 205636), which was defined by GeNorm and NormFinder softwares as the optimal reference (most stable) for CD4 T cells. Primers against the following targets were purchased from Exiqon: hsa-miR-146b-5p mimic (ID: 204553), hiv1-miR-TAR-5p mimic (ID: 204553) and hsa-miR-484 mimic (ID: 205636).

Balducci E., Leroyer A.S., Lacroix R., Robert S., Todorova D., Simoncini S., Lyonnet L., Chareyre C., Zaegel-Faucher O., Micallef J., Poizot-Martin I., Roll P, & Dignat-George F. (2019). Extracellular vesicles from T cells overexpress miR-146b-5p in HIV-1 infection and repress endothelial activation. Scientific Reports, 9, 10299.

+ Open protocol

+ Expand

miRNA and mRNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

MiRNA expression was analyzed with the miRCURY LNA™ Universal RT microRNA PCR system (Exiqon, Vedbaek, Denmark) using 100 ng RNA as starting material. Relative expression was determined by the 2^−ΔΔC_T method^{25 (link)} with 5S RNA as an endogenous control. The samples were run at least twice in triplicates.
For determining the target gene mRNA expression, 1 µg total RNA was reverse transcribed with iScript cDNA synthesis kit (Bio-Rad Laboratories Inc., Hercules, CA, USA). Subsequently, the cDNAs were diluted 1/10 and subjected to Taqman Fast qPCR with Gene Expression Assays from Applied Biosystems. Relative expression was determined by the 2^−ΔΔC_T method^{25 (link)} using GAPDH as an endogenous control. The samples were run three times with triplicates.

Leivonen S.K., Icay K., Jäntti K., Siren I., Liu C., Alkodsi A., Cervera A., Ludvigsen M., Hamilton-Dutoit S.J., d’Amore F., Karjalainen-Lindsberg M.L., Delabie J., Holte H., Lehtonen R., Hautaniemi S, & Leppä S. (2017). MicroRNAs regulate key cell survival pathways and mediate chemosensitivity during progression of diffuse large B-cell lymphoma. Blood Cancer Journal, 7(12), 654.

+ Open protocol

+ Expand

Protein and miRNA Extraction and Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Protein extraction and Western blot analysis were carried out as described [17 (link)]. Details of the antibody dilutions used for Western blot are as follows: LXRα (1:500 dilution, #ab41902, Abcam, Cambridge, UK), ABCA1 (1:1000, #NB400-105, Novus Biologicals, Cambridge, UK), GAPDH (1:1000, #sc-365062, Santa Cruz Biotechnology, TX, USA), and Calnexin (1:1000, #sc-11397, Santa Cruz Biotechnology, TX, USA).
RNA extraction and quantitative real time PCR are described in detail in the Supplementary material. In short, total RNA was extracted with Trifast (Peqlab, Erlangen, Germany) and reverse transcribed (High Capacity cDNA Reverse Transcription Kit, Applied Biosystems, Carlsbad, CA). The quantity of RNA used in quantitative real time PCR was optimized prior to obtain ct values within the range of 18–30.
For mature miR-206 quantification the miRCURY LNA™ Universal RT microRNA PCR system (Exiqon, Vedbaek, Denmark) was used together with miR-206 or U6 (reference gene) specific predesigned LNA primers. Quantitative real time PCR was carried out using gene specific primers and QuantiFast SYBR Green PCR Kit (Qiagen, Germany) on LC480 (Roche Diagnostics, Basel, Switzerland). All samples were normalized to cyclophilin A mRNA expression. Experiments were carried out in triplicates.

Vinod M., Chennamsetty I., Colin S., Belloy L., De Paoli F., Schaider H., Graier W.F., Frank S., Kratky D., Staels B., Chinetti-Gbaguidi G, & Kostner G.M. (2014). miR-206 controls LXRα expression and promotes LXR-mediated cholesterol efflux in macrophages. Biochimica et Biophysica Acta, 1841(6), 827-835.

+ Open protocol

+ Expand

miRNA Quantification via RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

cDNA synthesis and qPCR were performed using a miRCURY LNA Universal RT microRNA PCR system (Exiqon) according to the manufacturer’s protocol. Two microlitre of RNA extract was reverse transcribed in a 10 μl final reaction volume using Universal cDNA Synthesis Kit ll (Exiqon). The resulting cDNA was diluted in nuclease-free water containing ROX passive reference dye (Invitrogen) at a final concentration of 500 nM. Individual qPCR was performed on diluted cDNA using the ExiLENT SYBR Greenmastermix (Exiqon) and LNAPCR primers (Exiqon) for miR-141-3p and miR-375-3p. Real-time PCR amplification was performed in duplicate on an Applied Biosystems 7900HT system using a cycle condition according to the template file (available at www.exiqon.com/sds).

Cai S., Pataillot-Meakin T., Shibakawa A., Ren R., Bevan C.L., Ladame S., Ivanov A.P, & Edel J.B. (2021). Single-molecule amplification-free multiplexed detection of circulating microRNA cancer biomarkers from serum. Nature Communications, 12, 3515.

+ Open protocol

+ Expand

Quantifying Mature microRNA Levels in Cells and Biofluid Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

q-PCR for detection of mature miR-146a-5p, miR-181a and miR-223 microRNAs was performed using the miRCURY LNA™ Universal RT microRNA PCR system (Exiqon) according to the manufacturer’s instructions. The assays were run on a QuantStudio™ 5 (ThermoFisher Scientific, Waltham MA, USA) real-time PCR system. Relative quantification was calculated using the QuantStudio™ 5 design and analysis software (Applied Biosystems, Foster City CA, USA) (based on the 2nd derivative maximum). In the RNase I protection assay, where the endogenous control (RNU1A1) is degraded as well as the miRNAs of interest as consequence of RNase treatment, the relative abundance of miRNAs was calculated from the expression 2^ − (C_{texperimental} − C_tcontrol), expressed in percentage [72 ]. The miRNA contents of human CSF EVs and of cultured neurons were analysed independently of any other sample, therefore the relative abundance was expressed as dC_t: C_ttarget − C_treference, where RNU1A1 is considered as the endogenous control.

Exiqon primers	Cat. number
rno-miR-181a	Ref# 206081
rno-miR-146a-5p	Ref# 204688
mmu-miR-223	Ref# 205986
mmu-has-RNU1A1	Ref# EX203909

Prada I., Gabrielli M., Turola E., Iorio A., D’Arrigo G., Parolisi R., De Luca M., Pacifici M., Bastoni M., Lombardi M., Legname G., Cojoc D., Buffo A., Furlan R., Peruzzi F, & Verderio C. (2018). Glia-to-neuron transfer of miRNAs via extracellular vesicles: a new mechanism underlying inflammation-induced synaptic alterations. Acta Neuropathologica, 135(4), 529-550.

+ Open protocol

+ Expand

Validation of Dysregulated miRNAs in Bone Marrow

Check if the same lab product or an alternative is used in the 5 most similar protocols

Significantly dysregulated miRNAs were validated by Quantitative PCR (LightCycler 480, Roche Applied Science, Mannheim, Germany) after comparing the BM microarray miRNA expressions of patients with the controls. RNA was reverse-transcribed to cDNA by using a cDNA synthesis kit (Exiqon). For miRNA quantification, the miRCURY LNA Universal RT microRNA PCR system (Exiqon) was used in combination with the predesigned primers (Exiqon). A master mix was designed for each primer set in accordance with the recommendations of the real time RT-PCR setup for “individual assays,” suggested in the kit. The reaction conditions consisted of polymerase activation/denaturation at 95°C for 10 min. For miRNA quantification, 40 amplification cycles at 95°C for 10 sec and 60°C for 1 min were performed; this was then followed by signal detection. The Delta-Delta-Ct algorithm was used to determine relative gene expression, and SNORD48 and U6 were used for housekeeping genes.

Duyu M., Durmaz B., Gunduz C., Vergin C., Yilmaz Karapinar D., Aksoylar S., Kavakli K., Cetingul N., Irken G., Yaman Y., Ozkinay F, & Cogulu O. (2014). Prospective Evaluation of Whole Genome MicroRNA Expression Profiling in Childhood Acute Lymphoblastic Leukemia. BioMed Research International, 2014, 967585.

+ Open protocol

+ Expand

NSCLC miRNA and mRNA Expression Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

For all cell lines, RNA extraction and RT-qPCR experiments were conducted as previously described.^{22 (link)} From each formalin-fixed, paraffin embedded patient sample, RNA was extracted from a 1 × 7 μm section using the miRNeasy FFPE kit (217504, Qiagen, Germantown, MD, USA). miR expression analysis was performed using the miRCURY LNA Universal RT microRNA PCR system (203301, Exiqon, Woburn, MA, USA), whereas mRNA expression analysis was performed using the High Capacity Reverse Transcriptase Kit (4368813, Life Technologies) and TaqMan PreAmp Master Mix kit (4384267, ThermoFisher) according to manufacturer’s protocol. All RT-qPCR was performed in technical cDNA and qPCR duplicates using either hsa-miR-103a-3p and hsa-miR-423-5p or IPO8 and PUM1 as reference genes, as they have previously been reported stably expressed in NSCLC.^{25 (link), 26 (link)} All data was analyzed using NormFinder to ensure stability of the reference genes.^{27 (link)} For each sample, relative quantities were calculated as 2^−ΔCt and determined as the average relative quantities in the cDNA synthesis duplicates.

Daugaard I., Sanders K.J., Idica A., Vittayarukskul K., Hamdorf M., Krog J.D., Chow R., Jury D., Hansen L.L., Hager H., Lamy P., Choi C.L., Agalliu D., Zisoulis D.G, & Pedersen I.M. (2017). miR-151a induces partial EMT by regulating E-cadherin in NSCLC cells. Oncogenesis, 6(7), e366-.

+ Open protocol

+ Expand

Measurement of Placental miRNAs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Levels of candidate SHP-2 regulatory miRNAs were assessed in human first trimester and term placental tissue, primary human placental stromal or cytotrophoblast cells or human placental cells lines (BeWo, JAR, JEG, SWAN-71). Total RNA was extracted from cells or tissue using miRVANA miRNA extraction kits (Ambion). RNA quantity and purity were assessed by Nanodrop. All RNA samples had A₂₆₀/A₂₈₀values in the range of 1.93–2.08 and A₂₆₀/A₂₃₀ values in the range 2.05–2.14. Total RNA of 25 ng was reversed transcribed using miRCURY LNA™ Universal cDNA Synthesis kit (Exiqon). Individual miRNAs were detected using the miRCURY LNA™ Universal RT microRNA PCR system (Exiqon) and LNA-enhanced miRNA-specific primer sets (Exiqon) for hsa-miR-514a-3p (target sequence: AUUGACACUUCUGUGAGUAGA) and hsa-miR-758-3p (target sequence: UUUGUGACCUGGUCCACUAACC). All reactions were performed in duplicate using Stratagene MX3005P thermal cycler (Agilent Technologies) and 60°C annealing temperature. 5SrRNA was unaffected by treatment; therefore, the relative amount of miRNA was normalized to 5SrRNA. Fold changes in miRNA expression from control (mean of all ΔCt values) were calculated as 2^(−ΔΔ^Ct⁾, where ΔΔCt = ΔCt control − ΔCt treated sample and ΔCt = Ct_miRNA − Ct_5S_rRNA.

Quilang R.C., Lui S, & Forbes K. (2021). miR-514a-3p: a novel SHP-2 regulatory miRNA that modulates human cytotrophoblast proliferation. Journal of Molecular Endocrinology, 68(2), 99-110.

+ Open protocol

+ Expand

Profiling miRNA Expression in Glioma Stem Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

miRNA was isolated from human glioma stem and differentiated cells using the miRCURY RNA Isolation Kit (Cell and Plant, Exiqon) and quantified with a NanoDrop 2000 spectrophotometer. Relative miRNA expression between stem and differentiated samples was assessed via RT-qPCR with the miRCURY LNA Universal RT microRNA PCR system (Exiqon) and a StepOnePlus thermocycler (Applied Biosystems). The following miRNA LNA qpcr primer sets (Exiqon) were tested: hsa-miR-129-5p, hsa-miR-143-3p, hsa-miR-143-5p, hsa-miR-145-3p, hsa-miR-145-5p, hsa-miR-149-5p, hsa-miR-149-5p, hsa-miR-190b, hsa-miR-299-3p, hsa-miR-370-3p, hsa-miR-370-5p, hsa-miR-382-3p, hsa-miR-382-5p, hsa-miR-653-3p, hsa-miR-653-5p, let-7a-5p, 16-5p, 103a-3p, 191-5p, 423-3p, and 423-5p.

Zepecki J.P., Karambizi D., Fajardo J.E., Snyder K.M., Guetta-Terrier C., Tang O.Y., Chen J.S., Sarkar A., Fiser A., Toms S.A, & Tapinos N. (2021). miRNA-mediated loss of m6A increases nascent translation in glioblastoma. PLoS Genetics, 17(3), e1009086.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!