K1 toxin-encoding inducible plasmids were constructed by cloning reverse transcriptase PCR-derived K1 genes into pCR8 by TOPO-TA cloning (Thermo Fisher) using the primers PRUI1 and PRUI2 (Table S1 ). The nucleic acid sequence of all cloned K1 genes was confirmed by Sanger sequencing. Utilizing Gateway™ technology (Thermo Fisher), K1 genes were sub-cloned into the destination vector pAG426-GAL-ccdB to create the high copy number, galactose-inducible plasmids pEK005 (reference K1 sequence) and pEK006 (K1 BJH001) [32 (link)]. To amplify and clone a putative polymorphic frameshift region from ScV-LA1, we used reverse transcriptase-PCR with primers PRUI132 and PRUI133. Amplified cDNAs were cloned into pCR8 by TOPO-TA cloning (Thermo Fisher) and the nucleic acid sequence was confirmed by Sanger sequencing.
Topo ta cloning
Manufactured by Thermo Fisher Scientific
Sourced in United States, Germany
TOPO TA cloning is a simple and efficient method for the direct insertion of Taq polymerase-amplified PCR products into a plasmid vector. It provides a convenient way to clone PCR products without the need for restriction enzymes or ligase.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (5 mentions)
Superscript 3, by Thermo Fisher Scientific (3 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Lenticas9 egfp, by Addgene (2 mentions)
Platinum taq dna polymerase, by Thermo Fisher Scientific (2 mentions)
Pcr2.1 topo, by Thermo Fisher Scientific (2 mentions)
Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (2 mentions)
Phusion polymerase, by Thermo Fisher Scientific (2 mentions)
Epitect bisulfite kit, by Qiagen (2 mentions)
3 race system for the rapid amplification of cdna ends, by Thermo Fisher Scientific (2 mentions)
Facsaria 2, by BD (2 mentions)
Gateway technology, by Thermo Fisher Scientific (1 mentions)
Pcdna3.1 ct gfp topo vector, by Thermo Fisher Scientific (1 mentions)
Lentiguide puro vector, by Addgene (1 mentions)
One shot top10, by Thermo Fisher Scientific (1 mentions)
Lr clonase 2 plus enzyme mix, by Thermo Fisher Scientific (1 mentions)
Abi prism 3700 sequencer, by Thermo Fisher Scientific (1 mentions)
Rneasy protect mini kit, by Qiagen (1 mentions)
Lentiguide puro, by Addgene (1 mentions)
Plasmid isolation kit, by Thermo Fisher Scientific (1 mentions)
90 protocols using topo ta cloning
1
Cloning and Sequencing of K1 Toxin Genes
2
Unc-5 Locus Dissection and Mutagenesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
Unc-5 locus dissection was carried out by PCR-amplifications using genomic DNA as template to amplify overlapping fragments of random sizes. The PCR products were cloned using TOPO TA Cloning (Invitrogen), sequenced and recombined into destination vectors: pGateway-nlsVenus-attB and/or pGateway-Gal4 and integrated into the attP2 site [41 (link)]. The pGateway-Rluc vector was used for luciferase assays. PCR amplified tin was cloned into pActC-GFP or pAct5C-FLAG plasmids to generate GFP-Tin and FLAG-Tin used in ChIP or luciferase assays, respectively. For site directed mutagenesis of Tin binding sites the most conserved nucleotides within the CACTTGA consensus motif, the “CA” dinucleotide and the first “T” [24 (link)], were mutated to “GT” and “A“, respectively. The following primers were used for mutagenesis:CACGGTATAGAGGCAACGG and CCGTTGCCTCTATACCGTG for R8, GTTCGTCTACAGGGCAGTCAC and GTGACTGCCCTGTAGACGAAC for R9, and TGCTGTCTAGTTTTGTGTGTTCTG and CAGAACACACAAAACTAGACAGCA for R10.
+ Expand
Unc-5 locus dissection was carried out by PCR-amplifications using genomic DNA as template to amplify overlapping fragments of random sizes. The PCR products were cloned using TOPO TA Cloning (Invitrogen), sequenced and recombined into destination vectors: pGateway-nlsVenus-attB and/or pGateway-Gal4 and integrated into the attP2 site [41 (link)]. The pGateway-Rluc vector was used for luciferase assays. PCR amplified tin was cloned into pActC-GFP or pAct5C-FLAG plasmids to generate GFP-Tin and FLAG-Tin used in ChIP or luciferase assays, respectively. For site directed mutagenesis of Tin binding sites the most conserved nucleotides within the CACTTGA consensus motif, the “CA” dinucleotide and the first “T” [24 (link)], were mutated to “GT” and “A“, respectively. The following primers were used for mutagenesis:
3
Cloning and Expressing hnRNP, SMN1, and PLS3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human hnRNP F (NM 001098208.1) and hnRNP H2 (NM 019597.4) cDNA was cloned into pcDNA3.1/CT-GFP vector and human SMN1 (NM 000344.3) was cloned into pcDNA3.1/V5-His vector via TOPO TA cloning as described in the manufacturer’s protocol (Invitrogen). Human PLS3 (NM 005032.6) cDNA was cloned into pcDNA-Flag via MluI and NotI sites. The pcDNA3.1/CT-GFP-TOPO vector (Invitrogen) was used as a negative control for the co-immunoprecipitations.
4
CRISPR-Mediated CD226 Gene Knockout
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
An established LCL was transduced with the enhanced green fluorescent protein (EGFP) expression construct lentiCas9-EGFP (Addgene catalog no. 63592) and then subsequently transduced with one of three short guide RNAs (sgRNAs) expressed on the lentiguide-Puro vector (Addgene catalog no. 52963) to target the CD226 gene. Transduced cells were selected with puromycin and screened for efficiency of Cas9 cleavage by the Surveyor nuclease assay (37 (link)). Transduced cell lines were then assayed for CD226 mRNA and surface expression, of which two sgRNAs (sgCD226-1 and CD226-2) showed significantly reduced CD226 expression. Genetic lesions induced by Cas9 cleavage and error-prone DNA repair were sequenced by TOPO TA cloning (Invitrogen catalog no. 45003).
5
Degenerate PCR and in situ Hybridization for nanos Identification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In order to search for possible additional genes, degenerate PCR with larval A. virens cDNA was performed. The sequences for the selected degenerate primers are as follows: upstream primer 5′-TGYGTNTTYTGYMRNAMNAA-3′ and downstream primer 5′-GGRCARTAYTTDATNGTRTG-3′. No additional nanos-related gene fragments were identified. For RNA probes for in situ hybridization, a fragment of candidate sequence was isolated by gene-specific PCR and cloned. The sequences for the gene-specific primers are as follows: upstream primer 5′-GTTGTACGGAGATTGGAATCATTGG-3′ and downstream primer 5′-GCAACTAGGTCACACGACAGATG-3′. The amplified fragment was 1366 bp in length and included 774 bp of open reading frame (ORF), 48 bp 5′UTR, and 544 bp 3′UTR. The PCR product was inserted in a pCRII vector by using TOPO-TA cloning (Invitrogen) and used for the transformation of chemically competent E. coli (One Shot™ TOP10). When colonies with the correct insert were obtained and checked by sequencing, digoxigenin-labeled RNA probes (antisense and sense) were synthesized and used for in situ hybridization.
6
Characterization of Complete Mitochondrial Genomes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Complete mt genomes were characterized from single individual snails, one each from P. acuta isolates A and B. PCR primers (Table 1 ) were designed and optimized using Primer3 (Rozen & Skaletsky, 2000 ) to target conserved regions of mt genes that were identified in alignments of previously reported complete mt genome sequences from panpulmonate species and EST data available from GenBank (Lee et al., 2011 ; White et al., 2011 (link)). High fidelity, long distance (LD)-PCR (Advantage Genomic LA Polymerase Mix, Clontech) was used to generate overlapping amplicons that encompassed the complete mt genome. Amplicons were sequenced directly by primer walking (see above) at double coverage or higher. Chromatograms were edited by eye and assembled into contigs using Sequencher v. 5.0. Once mt genome sequences of isolates A and B were characterized completely, primers listed in Table 1 were used to generate seven overlapping PCR fragments (range 1931–2624 bp) from the same original genomic DNA templates, which completely covered the mt genomes. High fidelity LD-PCR amplicons were cloned (TOPO TA-cloning, Invitrogen) and sequenced completely to confirm the mt sequence data.
7
Lentiviral Overexpression of ACTA2 and PLAG1-ACTA2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The open reading frame (ORF) of ACTA2 and PLAG1-ACTA2 was amplified by PCR using in vitro mutagenesis to introduce a strong Kozak consensus sequence before the initiating ATG of each gene. These fragments were then cloned into the pCR8GWTOPO entry vector, using TOPO TA Cloning (Invitrogen) and the ORFs confirmed by Sanger sequencing. Multisite gateway recombinational cloning (LR Clonase II Plus Enzyme Mix, Invitrogen) was used to generate ACTA2_CMV51_pDest-665 and PLAG1-ACTA2_CMV51_pDest-665 lentiviral expression constructs by combining each entry vector with the C413-E36 CMV51p> entry vector and the pDest-665 destination vector (gift from PEL). The HPL1D (immortalized human small airway epithelial cell line) cells stably expressing either ACTA2 or PLAG1-ACTA2 were generated by transduction of the cells with lentivirus particles harboring the expression constructs followed by selection using 5 µg/mL of blasticidin.
8
cDNA Library Construction and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
According to the manufacturer’s instructions, total RNA was precipitated using the RNeasy Protect Mini Kit (Qiagen, Crawley, UK). The RNA sample concentrations were quantified by spectrometry. mRNA was purified using the Oligotex ARNm mini kit (Qiagen, Crawley, UK). The BD SMART PCR cDNA Synthesis kit (BD Biosciences) was used for cDNA libraries construction. The first strand was synthesised using BD PowerScript Reverse Transcriptase, the SMART IIA Oligonucleotide and the CDS IIA primer provided in the kit. The double-stranded cDNA was synthesised by PCR and purified using Micropure-EZ (Millipore). The cDNA products were analysed using agarose gel electrophoresis to determine their quality before cloning. cDNA was ligated into a TOPO vector and was transformed by TOPO TA cloning (Invitrogen) using TOP10 chemically competent E. coli cells. Libraries were plated on LB medium and grown at 37 °C overnight. Colonies were manually picked up for PCR amplification with M13 and T7 universal vector primers and subsequent sequencing with poly-T primer on an ABI Prism 3,700 sequencer (Applied Biosystems).
9
Generation of BFL-1 CRISPR/Cas9 Mutant LCLs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The BFL-1 CRISPR/Cas9 mutant LCL was generated by the Duke Functional Genomics Shared Resource. Cas9-expressing LCLs (lentiCas9-EGFP; Addgene #63592) were transduced with one of three short-guide RNAs (sgRNAs) that were specific to BFL-1 exon 1 and grown out under puromycin selection (lentiGuide-Puro; Addgene #52963). Each sgRNA was screened for efficiency of Cas9 cleavage by Surveyor nuclease assay and for reduced BFL-1 mRNA expression. LCLs transduced with the sgRNA resulting in both Cas9 cleavage of the target site and the most reduced mRNA expression were then serially diluted to obtain a clonal population. Clonality was ascertained by TOPO TA cloning (Invitrogen, Cat #45003).
10
Polyadenylation Analysis of rps23 mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Polyadenylation tests were performed as described previously (Win et al. 2006 (link)) using the 3′ rapid amplification of cDNA ends system (Invitrogen) and then PCR amplified using primer specific for rps23 mRNA and the adapter primer. PCR products were cloned (TOPO TA Cloning, Invitrogen) and sequenced using an ABI sequencer and ABI PRISM dRhodamine reagents (Applera UK).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!