Log In Sign up
The largest database of trusted experimental protocols

Erlotinib

Manufactured by Cell Signaling Technology
Visit Supplier
Sourced in United States

Erlotinib is a tyrosine kinase inhibitor that targets the epidermal growth factor receptor (EGFR). It is commonly used as a research tool to study EGFR signaling pathways.

Automatically generated - may contain errors

Lab products found in correlation

Rpmi 1640 medium, by Corning (1 mentions) 293t cell, by American Type Culture Collection (1 mentions) Dulbecco modified eagle medium (dmem), by Corning (1 mentions) Pdgf bb, by Cell Signaling Technology (1 mentions) Epidermal growth factor (egf), by Merck Group (1 mentions) Fr180204, by Merck Group (1 mentions) Sunitinib, by Cell Signaling Technology (1 mentions) U0126, by Cell Signaling Technology (1 mentions) Rabbit anti perk1 2 antibody, by Cell Signaling Technology (1 mentions) Rabbit anti phospho egf receptor tyr1068, by Cell Signaling Technology (1 mentions) Rabbit anti erk2 antibody, by Santa Cruz Biotechnology (1 mentions) Tetracycline free fbs, by Takara Bio (1 mentions) Rpmi 1640 medium, by American Type Culture Collection (1 mentions) Doxycycline hyclate, by Merck Group (1 mentions) Penicillin streptomycin solution, by Lonza (1 mentions) Anaerocult a system, by Merck Group (1 mentions) Cocl2, by Merck Group (1 mentions) Staurosporine, by Merck Group (1 mentions) Azd9291, by Apexbio (1 mentions) Anti flag antibody, by Merck Group (1 mentions)

16 protocols using erlotinib

1

Characterization of EGFR-mutant NSCLC Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
EGFR mutant PC-9 and HCC827 (ΔE746-A750) and PC-9/ER, PC-9/ERC15, PC-9/ERC16, and HCC827/ER (ΔE746-A750; T790M) NSCLC cells were provided by Dr. William Pao (Vanderbilt University). erlotinib resistant cells were derived as described and characterized (27 ). AZD9291 resistant cells were derived as described and characterized (28 ). Cell lines were authenticated and sequenced for signature mutations (27 ). EGFR TKI resistant lines were maintained in the presence of 1μM erlotinib (Cell Signaling Technology) throughout the study (refreshed every 72 hours) although experiments were routinely conducted after a 72 hour drug holiday. ALW-II-41-27 and NG-25 were generously provided by Nathanael Gray (Dana-Farber Cancer Institute, Harvard Medical School). ALW-II-41-27 was determined to have >99.7% purity by LCMS analysis. 293T cells used for lentivirus production were purchased from ATCC.
All lung cancer cell lines were cultured in RPMI-1640 medium (Corning/Cellgro) supplemented with L-glutamine (2mM), 10% fetal bovine serum (FBS) (Thermo Scientific, HyClone Laboratories Inc.), penicillin (100U/mL), and streptomycin (100μg/mL). 293T cells were grown in DMEM (Corning/Cellgro) supplemented with L-glutamine (2mM), and 10% FBS. All cells were grown in a humidified incubator with 5% CO2 at 37°C.
Amato K.R., Wang S., Tan L., Hastings A.K., Song W., Lovly C.M., Meador C.B., Ye F., Lu P., Balko J.M., Colvin D.C., Cates J.M., Pao W., Gray N.S, & Chen J. (2016). EPHA2 blockade overcomes acquired resistance to EGFR kinase inhibitors in lung cancer. Cancer research, 76(2), 305-318.
+ Open protocol
+ Expand
2

Synthesis and Characterization of Photosensitizers

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
Synthesis, isolation and analysis of HPPH and its 172 methylester derivative HPPH-ME [19 (link)], PS-531-COOH and PS-531-ME [19 (link)], erlotinib-conjugates PS-908 [10 (link)], and PS 5 to PS 43 (Figure 1) [11 (link)] have been previously reported. Each PS preparation used for tissue culture and in vivo studies has been verified by mass spectrometry and nuclear magnetic resonance analysis for purity of >96% and to be without trace of free erlotinib. Stock solutions of the PSs with concentrations ranging from 0.3 to 1.2 mM were prepared in H2O containing 5% glucose, 0.1% Tween 80 and 0.1% ethanol and diluted in culture medium or injection solution immediately prior to use. The concentrations of PSs in the treatment media were confirmed by using medium aliquots, diluted 10-fold in methanol, removed precipitated proteins by centrifugation and determined PS concentration in the supernatant by fluorometry. Stock solution of erlotinib (Cell Signaling Technology, Danvers, MA, USA) was prepared in DMSO (10 mM) and aliquots diluted into medium for cell treatment.
Tracy E.C., Cheruku R.R., Pandey R.K, & Baumann H. (2022). Tumor Cell-Specific Retention and Photodynamic Action of Erlotinib-Pyropheophorbide Conjugates. International Journal of Molecular Sciences, 23(19), 11081.
+ Open protocol
+ Expand
3

Cisplatin Resistance Induction in Ovarian Cancer

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
As originally demonstrated in [20 (link)], resistance to cisplatin can be increased in ovarian cancer cells by repeated sequential treatments with cisplatin followed by drug free recovery times. Our cisplatin resistance paradigm was modeled from [20 (link)]. Briefly, OVCA 433 cells were treated with cisplatin for 48 hours then allowed to recover for at least 48 hours after drug treatment. Cells completed three cycles of each concentration of cisplatin followed by drug free recovery times before being exposed to the next higher dose. The doses of cisplatin used were 3, 6 and 9 μM. Cells completing this paradigm were termed Cisplatin resistant (CPR) cells. Passage control cells (not undergoing cisplatin treatments) were carried out in parallel. EGFR was inhibited by treating cells with 1 μM Erlotinib (Cell Signaling, Danvers, MA) for at least 1 hour prior to drug treatments with cisplatin. Erlotinib was maintained in the culture media for 48 hours with cisplatin treatments and then cells were allowed to recover from all drug treatment in MEME growth media during drug free intervals.
Granados M.L., Hudson L.G, & Samudio-Ruiz S.L. (2015). Contributions of the Epidermal Growth Factor Receptor to Acquisition of Platinum Resistance in Ovarian Cancer Cells. PLoS ONE, 10(9), e0136893.
+ Open protocol
+ Expand
4

Inhibition of PDGF and EGF Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols
Sunitinib, erlotinib, U0126 (all purchased from Cell Signaling Technology, Danvers, MA, USA) and FR180204 (Sigma-Aldrich, St. Louis, MO, USA) were prepared as a 20 mM stock solution in dimethyl sulfoxide (DMSO) and stored at −20 °C. PDGF-BB (Cell Signaling Technology) was prepared at a concentration of 100 µg/mL in 20 mM citric acid (pH 3.0) supplemented with 0.8% BSA (bovine serum albumin) and stored at 4 °C. EGF (Sigma-Aldrich) was prepared at a concentration of 100 µg/mL in 10 mM HCl and stored at 4 °C. For the determination of proliferative activity, concentrations of protein kinase inhibitors (PKIs) ranging from 0.001 to 10 μM and PDGF-BB concentrations of 0.25 and 10 ng/mL were tested. For Western blot analyses, PKI concentrations ranging from 0.05 to 10 μM, PDGF-BB concentrations of 10 and 30 ng/mL and EGF concentrations of 40 and 100 ng/mL were used.
Sramek M., Neradil J., Macigova P., Mudry P., Polaskova K., Slaby O., Noskova H., Sterba J, & Veselska R. (2018). Effects of Sunitinib and Other Kinase Inhibitors on Cells Harboring a PDGFRB Mutation Associated with Infantile Myofibromatosis. International Journal of Molecular Sciences, 19(9), 2599.
+ Open protocol
+ Expand
5

EGFR Signaling Inhibition in Breast Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
To inhibit the EGFR signaling pathway, 70% confluent BT-549 and MDA-MB-231 cells were cultured with serum free medium overnight followed by a 5-hour incubation in medium containing 10 μM EGFR small molecule inhibitor Erlotinib (Cell Signaling Technology, Beverly, MA). Epidermal growth factor receptor inhibition was verified by immunoblotting with rabbit anti-Phospho-EGF Receptor (Tyr1068) (Cell Signaling Technology). The PI3K pathway was analyzed using rabbit anti-p-Akt and rabbit anti-Akt antibodies (Cell Signaling Technology), and mitogen-activated protein kinase (MAPK) pathway inhibition by immunoblotting with a rabbit anti-p-ERK 1/2 antibody (Cell Signaling Technology) and a rabbit anti-ERK 2 antibody (Santa Cruz Biotechnology, Santa Cruz, CA).
Heuser V.D., Mansuri N., Mogg J., Kurki S., Repo H., Kronqvist P., Carpén O, & Gardberg M. (2018). Formin Proteins FHOD1 and INF2 in Triple-Negative Breast Cancer: Association With Basal Markers and Functional Activities. Breast Cancer : Basic and Clinical Research, 12, 1178223418792247.
+ Open protocol
+ Expand
6

Cell Culture Conditions for PC-9 and H358

Check if the same lab product or an alternative is used in the 5 most similar protocols
PC9 (PC-9) and H358 (NCI-H358) cells were obtained from Dr Romel Somwar at Memorial Sloan-Kettering Cancer Center. Cells were maintained in RPMI-1640 medium (ATCC, Manassas, VA) supplemented with 10% Tetracycline-free FBS (Clontech, Mountain View, CA) and 1% penicillin-streptomycin solution (Lonza, Basel, Switzerland). Cells were cultured at 37°; air; 95%; CO2, 5%. Cell lines were authenticated by multiplex PCR (Genewiz, South Plainfield, NJ). Where indicated, doxycycline hyclate (Sigma-Aldrich, St. Louis, MO) was added at the time of cell seeding at 100 ng/ml. Erlotinib (Cell Signaling) was added at the time of cell seeding at 1 μM.
Unni A.M., Lockwood W.W., Zejnullahu K., Lee-Lin S.Q, & Varmus H. (2015). Evidence that synthetic lethality underlies the mutual exclusivity of oncogenic KRAS and EGFR mutations in lung adenocarcinoma. eLife, 4, e06907.
+ Open protocol
+ Expand
7

Oxygen Regulation in HNSCC Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
For all treatments, cells were seeded and maintained in a humidified incubator at 5% CO2 and 37°C for 24 h before the experimental conditions were applied. For mild hypoxia (1% O2) cells were transferred to a low-oxygen incubator prepared according to the protocol of Wright and Shay (27 (link)). In brief, cell culture dishes were placed in gas-tight containers that were flushed with a well-defined gas mixture consisting of 1% O2, 5% CO2, and 94% N2 and were placed in an incubator at 5% CO2 and 37°C for 48 h. Anoxia (<0.01% O2) was induced by using the Anaerocult® A-System (Merck, Darmstadt, Germany) in gas-tight containers for 24 and 48 h. Anoxic conditions were monitored through the Anaerotest®-System (Merck, Darmstadt, Germany). Normoxic HNSCC cells were cultured under atmospheric oxygen (21% O2) at 5% CO2 and 37°C. Treatments with CoCl2 (Merck, Darmstadt, Germany) at 150 µM for 48 h, staurosporine (Merck, Darmstadt, Germany) at 1 µM for 2, 4, and 6 h and erlotinib (Cell Signaling Technology, Danvers, USA) at 1 µM for 72 h was conducted at atmospheric oxygen at 5% CO2 and 37°C.
Zahnreich S., Gebrekidan S., Multhoff G., Vaupel P., Schmidberger H, & Mayer A. (2021). Oxygen Deprivation Modulates EGFR and PD-L1 in Squamous Cell Carcinomas of the Head and Neck. Frontiers in Oncology, 11, 623964.
+ Open protocol
+ Expand
8

Evaluation of TKI Cytotoxicity in Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were seeded in 24-well plates at densities of either 8 × 104 cells/well or 2–3 × 104 cells/well if they were transfected with siRNA prior to TKI treatment. The growth medium was replaced by serum-free medium for 16 h. Afterwards, the cells were treated with 10 µM, 1 µM, and 0.1 µM AZD9291 (ApexBio Technology, Houston, TX, USA) or erlotinib (Cell Signaling Technology, Frankfurt A.M., Germany) in growth medium for 24 h. As a control, growth medium with 0.1% DMSO was used. The experiments were repeated three times with three or four technical repeats each.
Richtmann S., Wilkens D., Warth A., Lasitschka F., Winter H., Christopoulos P., Herth F.J., Muley T., Meister M, & Schneider M.A. (2019). FAM83A and FAM83B as Prognostic Biomarkers and Potential New Therapeutic Targets in NSCLC. Cancers, 11(5), 652.
+ Open protocol
+ Expand
9

Anti-EGFR Aptamer Synthesis and Assay

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
2′F-Pyrimidines RNA anti-EGFR CL4 aptamer and the scrambled CL4Sc sequence, used as a negative control, were synthesized by TriLink Biotechnologies and purchased from Tebu-bio srl (Magenta, Milan, Italy).
CL4: 5′GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC3′;
CL4Sc: 5′UUCGUACCGGGUAGGUUGGCUUGCACAUAGAACGUGUCA3′.
Before each treatment, the aptamers were subjected to a short denaturation-renaturation step as reported26 (link). Erlotinib (Cell Signaling Technology Inc., Danvers, MA) and cetuximab (ImClone Systems LLC, Branchburg, NJ) were used as EGFR inhibitors.
Camorani S., Crescenzi E., Gramanzini M., Fedele M., Zannetti A, & Cerchia L. (2017). Aptamer-mediated impairment of EGFR-integrin αvβ3 complex inhibits vasculogenic mimicry and growth of triple-negative breast cancers. Scientific Reports, 7, 46659.
+ Open protocol
+ Expand
10

GREM1 Regulates EGFR Signaling in Breast Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
MCF-10A, MCF-10A-ras, MDA-MB-453, MDA-MB-468, SKBR3, MCF-7, T47D, and CCD-1068sk cells were originally obtained from American Type Culture Collection, and the BT474 cell line was obtained from Korean Cell Line Bank. The cells were cultured according to the standard procedure and maintained at 37 °C in a humidified atmosphere composed of 5% CO2/95% air. GREM1 antibody was purchased from Abcam and recombinant human GREM1 was obtained from R&D systems. Recombinant human EGF, anti-Flag antibody and cell linker kits (PKH26 and PKH67) were purchased from Sigma-Aldrich. Anti-ERRα, anti-p-EGFR/EGFR, anti-p-Akt/Akt, anti-p-ERK/ERK antibodies and erlotinib were obtained from Cell Signalling Technology. Expression plasmids of GREM1, ERRα, Flag-only, Flag-EGFR, and Flag-BMP2 were purchased from Sino Biological Inc. Fc-IgG1 and Fc-GREM1 were provided by ACROBiosystems. The lentiviral GREM1 clone was obtained from Genecopoeia. 3xERRE-luciferase, pcDNA4-myc-PGC-1α, EGFR-WT, EGFR-ECD and EGFR-ICD were provided by Addgene. XCT790, LY294002 and U0126 were purchased from Tocris.
Park S.A., Sung N.J., Choi B.J., Kim W., Kim S.H, & Surh Y.J. (2020). Gremlin-1 augments the oestrogen-related receptor α signalling through EGFR activation: implications for the progression of breast cancer. British Journal of Cancer, 123(6), 988-999.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!