The human cell line CCRF-CEM (CEM) was purchased from American Type Culture Collection (ATCC) with passage number 2–20 used for all experiments. Cells were seeded at a density of 50,000 cells/well in Millipore MultiScreen GV 96 well plates. 0.25 μCi of 3 H-dC (Moravek Biochemicals) were added to the cells simultaneously with varying concentrations of the dCK inhibitor at a final volume of 100 μL/well. After 1 hr at 37 °C, cells were washed four times with ice cold phosphate-buffered saline (PBS) using the Millipore Vacuum Manifold. The amount of incorporated probe was measured by scintillation counting with the PerkinElmer Microbeta.
Vacuum manifold
Manufactured by Merck Group
Sourced in United States
A vacuum manifold is a laboratory equipment used to provide a controlled vacuum environment for various applications. It consists of a central chamber connected to multiple ports, allowing for the simultaneous processing or filtration of multiple samples. The vacuum manifold facilitates the efficient handling and processing of liquids and solid samples in a variety of laboratory workflows.
Automatically generated - may contain errors
Lab products found in correlation
Ghp filter plate, by Pall Corporation (3 mentions)
Wallac 1409 dsa liquid scintillation counter, by PerkinElmer (2 mentions)
Dimethyl sulfoxide (dmso), by Merck Group (2 mentions)
2 picoline borane, by Merck Group (2 mentions)
Glacial acetic acid, by Merck Group (2 mentions)
96 well filter plate, by Merck Group (2 mentions)
Fluoxetine, by Santa Cruz Biotechnology (2 mentions)
Reserpine, by Merck Group (2 mentions)
Tetrabenazine, by Merck Group (2 mentions)
Unlabeled 5 ht, by Merck Group (2 mentions)
Ne or trp, by PerkinElmer (2 mentions)
Multiscreenhts plates, by Merck Group (2 mentions)
Filter count scintillation fluid, by PerkinElmer (2 mentions)
Ls6500, by Beckman Coulter (2 mentions)
Ccrf cem, by American Type Culture Collection (1 mentions)
Thermomixer comfort, by Eppendorf (1 mentions)
5600 tripletof analyzer qqtof, by AB Sciex (1 mentions)
Sep pak tc18 μelution plate, by Waters Corporation (1 mentions)
S1000 thermal cycler, by Bio-Rad (1 mentions)
Taq pcr core kit, by Qiagen (1 mentions)
26 protocols using vacuum manifold
1
Deoxyribonucleoside Kinase Inhibition Assay
2
LPMO Substrate Binding Kinetics
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Substrate binding
was assessed in reaction mixtures containing 0.5% (w/v) PASC or 1%
(w/v) β-chitin and 3 μM LPMO (full-length or truncated
WT MaAA10B) in 20 mM sodium phosphate buffer, pH
6.0. The reactions were incubated at 40 °C in an Eppendorf Comfort
Thermomixer set to 1000 rpm. At various time points (2.5, 5, 15, and
30 min), a sample was taken and filtered using a 0.45 μm filter
plate and a Millipore vacuum manifold to remove the insoluble substrate
and substrate-bound protein. The relative amount of protein in the
supernatant was determined by measuring the A280.
was assessed in reaction mixtures containing 0.5% (w/v) PASC or 1%
(w/v) β-chitin and 3 μM LPMO (full-length or truncated
WT MaAA10B) in 20 mM sodium phosphate buffer, pH
6.0. The reactions were incubated at 40 °C in an Eppendorf Comfort
Thermomixer set to 1000 rpm. At various time points (2.5, 5, 15, and
30 min), a sample was taken and filtered using a 0.45 μm filter
plate and a Millipore vacuum manifold to remove the insoluble substrate
and substrate-bound protein. The relative amount of protein in the
supernatant was determined by measuring the A280.
3
Radioligand Binding Assay for α1- and β1-Adrenoceptors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The α1- and β1-adrenoceptor radioligand binding assay was performed on rat cerebral cortex. [3H]-prazosin (19.5 Ci/mmol, α1-adrenoceptor) and [3H]-CGP-12177 (48 Ci/mmol, β1-adrenergic receptor) were used. The brains were homogenized in 20 volumes of an ice-cold 50 mM Tris-HCl buffer (pH 7.6) and were centrifuged at 20,000 × g for 20 min (0−4°C). The cell pellet was resuspended in the Tris–HCl buffer and centrifuged again. Radioligand binding assays were performed in plates (MultiScreen/Millipore). The final incubation mixture (final volume 300 μl) consisted of 240 μl of the membrane suspension, 30 μl of [3H]-prazosin (0.2 nM), [3H]-CGP-12177 (0.2 nM) solution and 30 μl of the buffer containing seven to eight concentrations (10−11−10−4 M) of the tested compounds. In order to measure the unspecific binding, 10 μM phentolamine (for [3H]-prazosin) and 1 μM of propranolol (for [3H]-CGP-12177) were applied. The incubation was terminated by rapid filtration through glass fiber filters (Whatman GF/C) using a vacuum manifold (Millipore). The filters were then washed twice with the assay buffer and placed in scintillation vials with a liquid scintillation cocktail. Radioactivity was measured in a WALLAC 1409 DSA liquid scintillation counter (Perkin Elmer, USA). All the assays were made in duplicate and the inhibitory constants (Ki) were estimated.
4
iTRAQ-Labelled Peptide 2D-LC-MS/MS
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 2D LC separation of our iTRAQ-labelled samples was carried out as reported previously [23 ]. Ninety-six μg (via multiple injections) of the labelled peptide mixture was injected using the micro-pickup mode into a Zorbax Bio-SCX II column (Agilent; SantaClara, CA, USA). A total of 78 fractions were eluted (2 min each) and collected on a 96 well v-bottom plate. The eluted fractions were subsequently combined to 11 fractions and then desalted with Sep-Pak® tC18 μElution Plate (WATERS) using a vacuum manifold (Millipore; Billerica, MA, USA) in accordance to the manufacturer's recommendations before second-dimension reversed-phase (RP) chromatography. The MS analysis was performed using a 5600 TripleTOF analyzer (QqTOF; AB SCIEX) in Information Dependent Mode.
5
2-AB Labeling of N-glycans
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The released N-glycans were labelled with 2-aminobenzamide (2-AB). The labelling mixture consisted of 2-AB (19.2 mg/ml; Sigma Aldrich, USA) and 2-picoline borane (44.8 mg/ml; Sigma Aldrich, USA) in dimethyl sulfoxide (Sigma Aldrich, USA) and glacial acetic acid (Merck, Germany) mixture (70:30 v/v). To each sample 25 μl of labelling mixture was added, followed by 2 h incubation at 65 °C. Free label and reducing agent were removed from the samples using hydrophilic interaction liquid chromatography solid-phase extraction (HILIC-SPE). After incubation samples were brought to 96% of acetonitrile (ACN) by adding 700 μl of ACN (J.T. Baker, USA) and applied to each well of a 0.2 μm GHP filter plate (Pall Corporation, USA). Solvent was removed by application of vacuum using a vacuum manifold (Millipore Corporation, USA). All wells were prewashed with 70% ethanol (Sigma-Aldrich, St. Louis, MO, USA) and water, followed by equilibration with 96% ACN. Loaded samples were subsequently washed 5× with 96% ACN. N-glycans were eluted with water and stored at − 20 °C until usage.
6
PRNP Gene Amplification and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The open reading frame (ORF) of PRNP gene (768 bp) was amplified from the genomic DNA with forward (PRNP-F: GGACACTGACACCCTCTTCATTTT) and reverse (PRNP-R: AAGGCCATCCTCATCCCACT) gene-specific primers. The PCR amplification was performed in a final volume of 50 μL, using the QIAGEN® Taq PCR Core Kit, according to the manufacturer’s protocol. The reaction contained 20 pmol of each primer, 5 μL of 10 × PCR Buffer, 10 μL of 5 × Q-Solution Buffer, 1 μL of dNTP mix (10 mM), 2.5 U of Taq DNA polymerase and 5 µL of 80 ng/μL DNA. DNA amplification was performed using an S-1000 Thermal Cycler (Bio-Rad, Hercules, California, USA) under the following thermocycling program conditions: denaturation at 94 °C for 2 min, 35 amplification cycles of denaturation at 94 °C for 45 s, annealing at 60 °C for 45 s, and extension at 72 °C for 1 min 30 s; followed by a final 10 min extension at 72 °C. Amplicons were analysed by electrophoresis on a 1.0% agarose and purified using the vacuum manifold from Millipore® at 24 Hg of pressure for 3 min. PCR-amplified fragments on both strands were sequenced by thecompany Stab-Vida (Portugal) and the chromatograms were analysed using Chromas 2.6.6. (Technelysium Pty Ltd, Australia).
7
Amplification and Sequencing of PRNP Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The open reading frame (ORF) of PRNP gene (771 bp) of all animals except fallow deer was amplified by performing a PCR using the reagents of the commercial kit of QIAGEN® (HotStarTaq® Master Mix Kit) and primers SILV-8 (fwd) (5′-AAAGCCACATAGGCAGCTGGAT-3′) and SILV-778 (rev) (5′-AGAAGATAATGAAAACAGGAAG-3′) [21 (link)] for roe and red deer; and PrP8 (fwd) (5′-CAGGTTAACGATGGTGAAAAGCCACATAGG-3′) and PrP9 (rev) (5′-GGAATTCTATCCTACTATGAGAAAAATGAGG-3′) [32 (link)] for Iberian wild goat and Pyrenean chamois. PCR reactions were purified using the vacuum manifold from Millipore®. Bi-directional sequencing was performed using the same PCR primers. Chromatograms were analysed using BioEdit v.4.8.6.
Fallow deer samples were PCR amplified with AmpliTaq Gold360 (Thermo Fisher Scientific) using either primer −143d (ATGGAATGTGAAGAACATTTATGACCTA) or primer −213d (AGGTCAACTTTGTCCTTGGAGGAG) in combination with primer +139u (TAAGCGCCAAGGGTATTAGCAT). Sequences were generated as described in Goldmann et al. [33 (link)] with oligonucleotide +70u GCTGCAGGTAGATACTCCCTC.
New sequences were deposited in Genbank with the following accession numbers: Cervus elaphus hispanicus KT845862-KT845864, Capra pyrenaica hispanica KT845865, Rupicapra pyrenaica pirenaica KT845866-KT845868.
Fallow deer samples were PCR amplified with AmpliTaq Gold360 (Thermo Fisher Scientific) using either primer −143d (ATGGAATGTGAAGAACATTTATGACCTA) or primer −213d (AGGTCAACTTTGTCCTTGGAGGAG) in combination with primer +139u (TAAGCGCCAAGGGTATTAGCAT). Sequences were generated as described in Goldmann et al. [33 (link)] with oligonucleotide +70u GCTGCAGGTAGATACTCCCTC.
New sequences were deposited in Genbank with the following accession numbers: Cervus elaphus hispanicus KT845862-KT845864, Capra pyrenaica hispanica KT845865, Rupicapra pyrenaica pirenaica KT845866-KT845868.
8
High-Throughput Glucose Uptake Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To measure uptake of glucose in a medium throughput format, 100 μL/well of PBS was added to 96-well filter plates (Millipore) with the Wellmate dispenser. Control wells included either 0 mM (positive control) or 20 mM (negative control) of the competitive inhibitor fructose in PBS. Compounds were added with the Biomek FX automated system. 90 μl of a cell suspension (1.1 x 108 cells/mL) was added to each well with the Wellmate dispenser and left at room temperature for 5 minutes before adding 10 μL of the substrate (4 mM [3H] D-glucose at 50 μCi/mL) to provide a final glucose concentration of 200 μM. After a 5 min incubation, the uptake reaction was stopped by adding 50 μL/well of 4% formaldehyde, followed by incubation for ~5 min. Cells were filtered and washed with a vacuum manifold (Millipore). Plates were dried overnight, 100 μL of scintillation fluid were added, and plates were then sealed and read on a TopCount NXT HTS from PerkinElmer. Data quality and analysis was performed using the GUItars program [22 (link)] and sigmoidal curve fitting with Pipeline Pilot platform (Accelrys, v. 7.0.1).
9
Radioligand Binding Assay for Adrenoceptors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The affinity of the obtained compounds were evaluated by radioligand binding assays (the ability to displace [3H]prazosin and [3H]clonidine from α1- and α2-adrenoreceptors, respectively) on rat cerebral cortex [33 (link),44 (link)]. The brains were homogenized in 20 volumes of ice-cold 50 mM Tris–HCl buffer (pH 7.6) and centrifuged at 20,000 × g for 20 min (0–4 °C). The cell pellet was resuspended in the Tris–HCl buffer and centrifuged again. Radioligand binding assays were performed in plates (MultiScreen/Millipore). The final incubation mixture (final volume 300 μL) consisted of 240 μL of the membrane suspension, 30 μL of [3H]prazosin (0.2 nM) or [3H]clonidine (2 nM) solution, and 30 μL of the buffer containing seven to eight concentrations (10−11–10−4M) of the tested compounds. For measuring the unspecific binding, phentolamine, 10 μM (in the case of [3H]prazosin) and clonidine, 10 μM (in the case of [3H]clonidine) were applied. The incubation was terminated by rapid filtration over glass fibre filters (Whatman GF/C) using a vacuum manifold (Millipore). The filters were then washed twice with the assay buffer and placed in scintillation vials with a liquid scintillation cocktail. Radioactivity was measured in a WALLAC 1409 DSA liquid scintillation counter. All assays were made in duplicate.
10
2-AB Labeling and Purification of N-Glycans
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The released N-glycans were labelled with 2-aminobenzamide (2-AB). The labelling mixture consisted of 2-AB (19.2 mg/ml; Sigma Aldrich, USA) and 2-picoline borane (44.8 mg/ml; Sigma Aldrich, USA) in dimethyl sulfoxide (Sigma Aldrich, USA) and glacial acetic acid (Merck, Germany) mixture (70:30 v/v). To each sample, 25 μl of labelling mixture was added, followed by 2 h incubation at 65 °C. Free label and reducing agent were removed from the samples using hydrophilic interaction liquid chromatography solid-phase extraction (HILIC-SPE). After incubation samples were brought to 96% of acetonitrile (ACN) by adding 700 μl of ACN (J.T. Baker, USA) and applied to each well of a 0.2 μm GHP filter plate (Pall Corporation, USA). Solvent was removed by application of vacuum using a vacuum manifold (Millipore Corporation, USA). All wells were prewashed with 70% ethanol (Sigma-Aldrich, St. Louis, MO, USA) and water, followed by equilibration with 96% ACN. Loaded samples were subsequently washed 5× with 96% ACN. N-glycans were eluted with water and stored at −20 °C until usage.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!