Log In Sign up
The largest database of trusted experimental protocols

Vic mgb probe

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in Germany

The VIC/MGB probe is a fluorescent probe used in real-time PCR (polymerase chain reaction) assays. It is designed to detect and quantify specific DNA or RNA sequences. The probe contains a fluorescent reporter dye (VIC) and a non-fluorescent quencher (MGB), which quenches the fluorescence of the reporter dye when the probe is intact. During the PCR amplification process, the probe binds to the target sequence and is cleaved, releasing the reporter dye and allowing it to emit fluorescence, which is detected by the real-time PCR instrument.

Automatically generated - may contain errors

Lab products found in correlation

High capacity rna to cdna kit, by Thermo Fisher Scientific (4 mentions) Taqman fast universal pcr master mix, by Thermo Fisher Scientific (2 mentions) Fam mgb, by Thermo Fisher Scientific (2 mentions) 7500 real time pcr system, by Thermo Fisher Scientific (2 mentions) Rneasy plus micro kit, by Qiagen (2 mentions) Prism 7900ht sequence detection system, by Thermo Fisher Scientific (1 mentions) Taqman universal pcr master mix, by Thermo Fisher Scientific (1 mentions) Abi 7300, by Thermo Fisher Scientific (1 mentions) M mlv reverse transcriptase, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

MGB probes (20 citations) VIC-MGB (11 citations) VIC probe (6 citations) Eukaryotic 18 S rRNA Endogenous Control (VIC™/MGB probe, (2 citations)

5 protocols using vic mgb probe

1

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA isolation was performed using a RNeasy Plus Micro Kit (74034, Qiagen). High-Capacity RNA-to-cDNA Kit (4387406, ThermoFisher Scientific) was used for reverse transcription. TaqMan Fast Universal PCR Master Mix (4352042, ThermoFisher Scientific) and primers for Chat (Mm01221882_m1, FAM-MGB, Thermo Fisher Scientific) and Gapdh (4352339E, VIC/MGB probe, Thermo Fisher Scientific) were used to quantify target genes. Gene expression was measured by 7500 Real Time PCR system (Applied Biosystems) and target gene expression was normalized to Gapdh.
Schloss M.J., Hulsmans M., Rohde D., Lee I.H., Severe N., Foy B.H., Pulous F.E., Zhang S., Kokkaliaris K.D., Frodermann V., Courties G., Yang C., Iwamoto Y., Knudsen A.S., McAlpine C.S., Yamazoe M., Schmidt S.P., Wojtkiewicz G.R., Masson G.S., Gustafsson K., Capen D., Brown D., Higgins J.M., Scadden D.T., Libby P., Swirski F.K., Naxerova K, & Nahrendorf M. (2022). B lymphocyte-derived acetylcholine limits steady-state and emergency hematopoiesis. Nature immunology, 23(4), 605-618.
+ Open protocol
+ Expand
2

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA isolation was performed using a RNeasy Plus Micro Kit (74034, Qiagen). High-Capacity RNA-to-cDNA Kit (4387406, ThermoFisher Scientific) was used for reverse transcription. TaqMan Fast Universal PCR Master Mix (4352042, ThermoFisher Scientific) and primers for Chat (Mm01221882_m1, FAM-MGB, Thermo Fisher Scientific) and Gapdh (4352339E, VIC/MGB probe, Thermo Fisher Scientific) were used to quantify target genes. Gene expression was measured by 7500 Real Time PCR system (Applied Biosystems) and target gene expression was normalized to Gapdh.
Schloss M.J., Hulsmans M., Rohde D., Lee I.H., Severe N., Foy B.H., Pulous F.E., Zhang S., Kokkaliaris K.D., Frodermann V., Courties G., Yang C., Iwamoto Y., Knudsen A.S., McAlpine C.S., Yamazoe M., Schmidt S.P., Wojtkiewicz G.R., Masson G.S., Gustafsson K., Capen D., Brown D., Higgins J.M., Scadden D.T., Libby P., Swirski F.K., Naxerova K, & Nahrendorf M. (2022). B lymphocyte-derived acetylcholine limits steady-state and emergency hematopoiesis. Nature immunology, 23(4), 605-618.
+ Open protocol
+ Expand
3

Mitochondrial DNA Copy Number Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols
A relative copy number of the mitochondrial DNA (mtDNA) was calculated as the number of mtDNA molecules in relation to nDNA molecules by real-time qPCR expression analysis of 5 ng DNA for a mitochondria-encoded NADH dehydrogenase subunit 1 (Mt-nd1) and the nuclear-encoded single copy gene for lipoprotein lipase (Lpl), normalized to 18S rRNA. Primer sequences: Mt-nd1—forward: CTACAACCATTTGCAGACGC/–reverse: GGAACTCATAGACTTAATGC/probe: CCAATACGCCCTTTAACAACCTC; Lpl—forward: GGTTTGGATCCAGCTGGGCC/–reverse: GATTCCAATACTTCGACCAGG/probe: CTTTGAGTATGCAGAAGCCC; Eukaryotic 18S rRNA-endogenous control (VIC™/MGB-probe) (Thermo Fischer Scientific, Germany) [27 (link)].
Fahlbusch P., Nikolic A., Hartwig S., Jacob S., Kettel U., Köllmer C., Al-Hasani H., Lehr S., Müller-Wieland D., Knebel B, & Kotzka J. (2022). Adaptation of Oxidative Phosphorylation Machinery Compensates for Hepatic Lipotoxicity in Early Stages of MAFLD. International Journal of Molecular Sciences, 23(12), 6873.
+ Open protocol
+ Expand
4

qRT-PCR Analysis of Folate Pathway Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
qRT-PCR was performed on a PRISM® 7900HT sequence detection system (Applied Biosystems, Foster City, CA, USA) using TaqMan® Universal PCR Master Mix (Applied Biosystems). Gene expression levels were normalized to those of β-actin (ACTB). The primers and TaqMan® probes were prepared using Assay-on-Demand gene-expression products (Applied Biosystems) and Human ACTB Endogenous Control (VIC / MGB Probe, Applied Biosystems). Probe IDs were Hs00195560_m1 for MTHFR, Hs01068263_m1 for MTHFD1, Hs00894582_m1 for GART, Hs01124179_g1 for FOLR1, Hs00758822_s1 for DHFR, and Hs00426586_m1 for TYMS.
Tsukihara H., Tsunekuni K, & Takechi T. (2016). Folic Acid-Metabolizing Enzymes Regulate the Antitumor Effect of 5-Fluoro-2′-Deoxyuridine in Colorectal Cancer Cell Lines. PLoS ONE, 11(9), e0163961.
+ Open protocol
+ Expand
5

Gene Expression Analysis of Corneal Cells

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted and processed, and qRT-PCR was performed, as previously described (Karamichos et al., 2011b (link)). Briefly, RNA was annealed with oligo dt and random hexamer primers, and first strand synthesis was carried out with MMLV reverse transcriptase (Life technologies; Grand Island, NY). Negative controls were performed without reverse transcriptase. The TaqMan® Gene Expression Master Mix and cDNA template produced were optimized for each assay. The cDNA template was incubated for an initial 2min at 50°C and 10min at 95°C, followed by 40–50 amplification cycles of 95°C for 15s and 60°C for 1min. qRT-PCR was performed using an ABI 7300 (Applied Biosystems; Foster City, CA). Target genes included Col3A1, Col5A1, Keratocan, Perlecan, Decorin, Lumican, Lysyl oxidase, alpha-smooth muscle actin (SMA), and Eukaryotic 18S rRNA Endogenous Control (VIC/MGB Probe: Primer Limited Applied Biosystems; Grand Island, NY). Results were calculated using the ΔΔCt method (Livak and Schmittgen, 2001 (link)), using 18S rRNA as the endogenous control. Values were plotted as the mean ± standard error (SEM).
Lee A., Karamichos D., Onochie O.E., Hutcheon A.E., Rich C.B., Zieske J.D, & Trinkaus-Randall V. (2018). Hypoxia Modulates the Development of a Corneal Stromal Matrix Model. Experimental eye research, 170, 127-137.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!