Aatii

A single targeting vector was generated to produce Hspb8^K141N KI and Hspb8 KO transgenic mouse lines. Briefly, the BAC clone bMQ-191J17 (Geneservice, Cambridge, UK) containing the full length mouse Hspb8 genomic DNA was used as starting material. The Neomycin (Neo) selection gene, floxed by Flp recombinase target (FRT) sites and followed by a loxP site, was retrieved from a pPGK-loxPFRT-Neo-FRT plasmid (gift from D. J. van Hengel, VIB Department for Molecular Biomedical Research, Ghent). Through PCR, a loxP site upstream of exon 2 was added, as well as specific restriction sites to allow further cloning, Southern blot analysis, and genotyping. The restriction enzymes used were AatII, BamHI, EcoRV, HindIII, MluI, NotI, SacII, SexAI, and XhoI (New England Biolabs, Ipswich, MA, USA). In a first step, all fragments were cloned individually in a pCR2.1_TOPO vector (Life Sciences, Little Chalfont, UK). Next, in vitro mutagenesis was performed to insert the K141N (c.423 G > C) mutation in the exon 2 of the Hspb8 gene. The final targeting vector contained (1) the K141N point mutation in exon 2 of the Hspb8 gene; (2) the Neo gene cassette, downstream of hspb8 exon 2; (3) two loxP sites to allow the excision of exon 2 and the Neo cassette to generate a functional Hspb8 KO mouse line.

Transposon mutants were grown in liquid minimal medium with 20 mM acetate to stationary phase, and genomic DNA was purified using a Yeast/Bact genomic DNA purification kit (Qiagen). 1 μg of genomic DNA was digested with the restriction enzyme AatII overnight at 37°C to generate fragments of genomic DNA which were, on average, 1,500 bp (New England Biolabs). The digestion product was then treated with Antarctic phosphatase for 1 h at 37°C (New England Biolabs). PCR products were purified using the Zymogen Clean and Concentrator PCR-cleanup kit (Zymo Research, Irvine, CA), and the recovered DNA fragments were ligated together to form closed circular DNA using T4 DNA ligase (New England Biolabs). The library of circular DNA fragments was used as a PCR template with forward and reverse primers specific to the transposable element and amplified using Phusion High-Fidelity DNA polymerase (New England Biolabs). PCR products were separated by electrophoresis on a 1% agarose gel and purified using the Zymoclean Gel DNA recovery kit (Zymo Research, Irvine, CA). The purified DNA fragments were sequenced using Sanger sequencing (GENEWIZ) using primers in (see Table S2).

RNA extracted from PBLs stimulated overnight with phorbol myristate acetate (PMA) was used to prepare cDNA. Amplification of targets of interest was carried out using the same primers used for qPCR and products were ligated into pGEM-T Easy (Promega, Australia). JM109 Competent cells (Promega, Australia) were transformed with the construct, ampicillin resistant colonies were grown in liquid culture and plasmid DNA was prepared using the QIAprep Spin Miniprep Kit (Qiagen, Australia). Sequences not amplified in this manner were synthetically produced by Integrated DNA Technologies. Cloned sequences were verified on both strands by Sanger sequencing. Plasmids were linerarised with AatII (New England Biolabs, USA) and standard curves were prepared immediately prior to each run.

Complementary oligonucleotides containing the nucleic acid sequences of the T7 promoter, the full shuT 5′ UTR, and the first five codons of shuT (Table S2) were combined and annealed in STE buffer (0.1mol L⁻¹ NaCl, 10 mmol L⁻¹ Tris‐HCl, 1 mmol L⁻¹ EDTA, pH 8.0) by boiling in a water bath for 10 min followed by slow cooling to room temperature. The generated double‐stranded DNA was then ligated into plasmid pXG10 (Urban & Vogel, 2007) that had been digested by restriction enzymes AatII (New England Biolabs inc.) and NheI (New England Biolabs inc.) to generate the run‐off plasmid pT7‐T, from which the 5′ portion of the shuT transcript would be generated for subsequent enzymatic RNA structure probing analysis.

pLl.LtrB-T7 mutant libraries for each selection cycle were generated by PCR with Mutazyme II (Stratagene) according to the manufacturer’s recommendations for 3 mutations per kb. Approximately 200 ng Ll.LtrB DNA template was mutagenized in a 50-μl PCR with primers 309S 5’- CACATCCATAACGTGCGCC and 308A 5’- TAATTGCTAGCCGGCCGCATTAAAAATGATATG for 30 cycles, and then re-amplified to obtain a higher yield using Phusion polymerase (New England Biolabs). The PCR product was purified from an agarose gel stained with Sybr gold (Invitrogen) under blue-light illumination and then digested overnight with AatII and NheI-HF (New England Biolabs). After purification, 750 ng of the insert was ligated to 1 μg of linearized and dephosphorylated pLl.LtrB-stuffer for 2 h at room temperature in a volume of 400 μl using T4 DNA ligase (4,000 units; New England Biolabs). The ligation mix was purified and concentrated to a volume of 6 μl using a Zymo clean and concentrator column and then electroporated into 100 μl E. coli MegaXDH10B cells (Invitrogen) with total transformants typically reaching >2 x 10⁸. The resulting library was purified by using an Endotoxin-free MiniKit II (Omega Biosciences) and transfected into HEK-293 Flp-In cells for both targeting and selection experiments.