Split luciferase assays were carried out as previously described (49 (link)–51 (link, link)), with modifications. Briefly, pneumococcal cells were grown in a C + Y medium (with 50 µM IPTG where required) at 37 °C until OD550 0.1, and competence was induced by the addition of 100 ng mL−1 CSP. The cells were then incubated for 10 min at 37 °C before the addition of R1501 chromosomal DNA (250 ng µL−1) where noted, followed by a further 5 min incubation at 37 °C. The cells were then washed in fresh C + Y medium and 1% NanoGlo substrate (Promega) was added and luminescence was measured 20 times every 1 min in a plate reader (VarioSkan luminometer, ThermoFisher). Data are represented as mean ± SEM calculated from nine independent repeats, with individual data points plotted.
Varioskan luminometer
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Varioskan luminometer is a high-performance multimode microplate reader designed for luminescence-based assays. It offers sensitive detection and accurate quantification of various luminescent signals, including bioluminescence, chemiluminescence, and flash/glow-type luminescence.
Automatically generated - may contain errors
Lab products found in correlation
Nano glo substrate, by Promega (1 mentions)
Viewplate, by PerkinElmer (1 mentions)
Britelite plus reporter gene assay system, by PerkinElmer (1 mentions)
293t cell, by American Type Culture Collection (1 mentions)
Tm4 sertoli cell line, by American Type Culture Collection (1 mentions)
Proteasome glotm assay kit, by Promega (1 mentions)
Britelite plus reagent, by PerkinElmer (1 mentions)
Black viewplate, by PerkinElmer (1 mentions)
Bradford protein assay, by Merck Group (1 mentions)
9 protocols using varioskan luminometer
1
Pneumococcal Transformation Efficiency Assay
2
Pseudotyped Lentivirus Neutralization Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Preparations of LV-Luc Wuhan, Alpha, Beta, Gamma and Delta pseudotypes (LV-Luc/Spike-C3, LV-Luc/Spike-UKC3, LV-Luc/Spike-SAC3, LV-Luc/SpikeBRC3 and LV-Luc/SpikeINd19) were titered in VERO E6 cells seeded in a 96-well plate (View plate, PerkinElmer) at a density of 20000 cells/well. After 48 h, luciferase expression was determined by the britelite plus Reporter Gene Assay System (PerkinElmer) and measured with a Varioskan luminometer (Thermo Fisher). Dilutions providing 150000-200000 relative luminescence units (RLU) were used in the neutralization assay. Briefly, mAb serial 2-fold dilutions starting from 20 µg/ml were incubated in duplicate with the Wuhan, Alpha, Beta, Gamma and Delta LV-Luc pseudoviruses for 30 min at 37°C in 96-deep well plates (Resnova, Genzano di Roma, Italy), and thereafter added to VERO E6 cells seeded in a 96-well View plate at a density of 20000 cells/well. Virus-only and cell-only controls were included. After 48 h, luciferase expression was determined by the britelite plus Reporter Gene Assay System (PerkinElmer). RLU data points were converted to a percentage neutralization value, calculated relative to virus-only controls. Results are expressed as inhibitory concentration (IC) 50 corresponding to the mAb concentration giving 50% inhibition of infection (neutralization) compared to the virus control wells (16 (link)).
3
Transcriptional Reporter Assays for NFkB, CREB, and SOX
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pNFkB-luc (LR-2001), pCREB-luc (LR-2008), and pSOX5-luc (LR-2090) reporter plasmid constructs harboring six consensus regulatory elements for NFkB (5′-GGGAATTTCC-3′), three consensus regulatory elements for CREB (5′-TGACGTCA-3′), or four consensus regulatory elements for SOX (5′-TCAACAATCC-3′), respectively, were purchased from Signosis Inc. (Santa Clara, CA, USA). The SOX5 DNA regulatory elements of the pSOX5-luc plasmid can also be recognized by other members of the SOX family. Hence, this plasmid is referred to as pSOX-luc in the remainder of this manuscript. For the pNFkB-luc plasmid, the inserted sequence can be recognized by RELA, NFkB1, or NFkB2 according to the JASPAR database [41 (link)]. The human −670 to +92 bp CDH1 promoter/luciferase reporter construct (#42083) was purchased from Addgene (Watertown, MA, USA). For transfections, PC-3 cells were plated in 96-well plates, incubated for 24 h, and transfected using polyethylenimine according to the method described previously [42 (link)]. After an incubation of 48 h, cells were treated with increasing concentrations of the indicated molecules for 6 h, followed by cell lysis and measurement of luciferase activity using a Varioskan luminometer (Thermo Scientific, Waltham, MA, USA).
4
Dual-Luciferase Assay for miRNA-mediated Gene Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 293 T cells (ATCC) were used for dual-luciferase reporter assay. 104 cells were seeded into 96 well plates, and luciferase reporter gene was transfected into 293 T cells when the cell confluence was 70%. Then 50 ng of wild-type plasmid pmirGLO-WT-Vec-3′UTR (or mutant plasmid Mut-Vec-3′UTR) and 50 ng of control plasmid was transfected into 293 T cells. Then 100 pmol mL−1 of miRNA365 mimic (miR365mic) or miR365 negative control mimic (miRNA NC) was transfected into 293 T cells, respectively. After 48 h transfection, cell culture medium was discarded and washed one time with 100 μl PBS. Then cells were lysed and the fluorescence activity was measured by Thermo Fisher Varioskan Luminometer. The fluorescence activity of luciferase was determined by calibrating with the activity of Renilla luciferase.
5
Mouse TM4 Sertoli Cell Transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mouse TM4 Sertoli cell line [29 (link)] was obtained from American Type Culture Collection (Manassas, VA, USA) and cultured as previously reported [22 (link)]. Cells were transfected using polyethylenimine according to the previously described method [23 (link)]. Forty-eight hours after transfection, cells were lysed and luciferase activities were measured using a Varioskan luminometer (Thermo Scientific, Waltham, MA, USA).
6
Proteasome Activity Assessment in Skeletal Muscle
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Proteasome activity was assessed using Proteasome-GloTM Assay kit (Promega) following the manufacturer's instruction. The trypsin-like and chymotrypsin-like activity assays were conducted using skeletal muscle homogenates in a total volume of 100 µl in opaque 96-well plates. For the assays, 120 µg of protein was added to assay buffer containing 20 mM Tris-HCl (pH 7.2), 0.1 mM EDTA, 5 mM ATP, 1 mM β-mercaptoethanol, 20% glycerol and 0.04% Nonidet P40. The individual proteasome reagents were added separately, and 30 min later, the luminescence was recorded as relative light units on a Varioskan luminometer (Thermo Scientific). Each sample was measured in triplicate.
In addition, to evaluate proteasome activity more precisely, dual measurements with or without the addition of 30 µM of the irreversible and highly specific proteasomal inhibitor adamantine-acetyl-(6-aminohexanoyl)3-(leucinyl)3-vinyl-(methyl)-sulfone (AdaAhx3L3VS, Calbiochem, catalog number 114802) were carried out (Kessler et al., 2001 (link)).
In addition, to evaluate proteasome activity more precisely, dual measurements with or without the addition of 30 µM of the irreversible and highly specific proteasomal inhibitor adamantine-acetyl-(6-aminohexanoyl)3-(leucinyl)3-vinyl-(methyl)-sulfone (AdaAhx3L3VS, Calbiochem, catalog number 114802) were carried out (Kessler et al., 2001 (link)).
7
Monitoring Competence Gene Expression in Streptococcus pneumoniae
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For monitoring of competence gene expression using transcriptional fusions, an S. pneumoniae DNA promoter fragment (HindIII—BamHI) was inserted upstream of the luc gene carried by pR424 [24 (link)] or pR414 plasmid [68 (link)]. Homology-dependent integration of the non-replicative recombinant plasmid into the pneumococcal chromosome was selected using chloramphenicol or erythromycin resistance respectively.
For the monitoring of growth and luciferase expression, precultures were gently thawed and aliquots were inoculated (OD550nm of 0.005) in luciferin-containing C+Y medium (pH 7.9) as previously described [69 (link)] and distributed into a 96-well (300 μl per well) white microplate with clear bottom (Corning). Relative luminescence units (RLU) and OD492nm values were recorded at defined time points throughout incubation at 37°C in a Varioskan luminometer (ThermoFisher).
Transformation frequency was measured by mixing cells with a DNA fragment carrying the point mutation rpsL41 that confers streptomycin resistance. The 3434pb rpsL PCR fragment was generated using primers MB117 (AATCTCCGCTGTAGGTCACTTTCTT) and MB120 (TTGGATTGGGTGTGCATTTGC). After 300 minutes, cells were collected and plated on selective and non-selective media.
For the monitoring of growth and luciferase expression, precultures were gently thawed and aliquots were inoculated (OD550nm of 0.005) in luciferin-containing C+Y medium (pH 7.9) as previously described [69 (link)] and distributed into a 96-well (300 μl per well) white microplate with clear bottom (Corning). Relative luminescence units (RLU) and OD492nm values were recorded at defined time points throughout incubation at 37°C in a Varioskan luminometer (ThermoFisher).
Transformation frequency was measured by mixing cells with a DNA fragment carrying the point mutation rpsL41 that confers streptomycin resistance. The 3434pb rpsL PCR fragment was generated using primers MB117 (AATCTCCGCTGTAGGTCACTTTCTT) and MB120 (TTGGATTGGGTGTGCATTTGC). After 300 minutes, cells were collected and plated on selective and non-selective media.
8
Lentiviral Neutralization Assay for SARS-CoV-2 Antibodies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Integrase competent Lentiviral Vector expressing Luciferase (LV-Luc) and pseudotyped either with Indiana or Cocal VSV.G were tittered in VERO E6 cells and used in the neutralization assays66 (link),67 (link). Briefly, 5-fold serial dilutions starting from 1/100 of heat inactivated sera from immunized monkeys were incubated with 200.000 relative luminescence units (RLU) of LV-Luc/VSV.GIn or LV-Luc/VSV.GCo in 96 deep well plate plates (Resnova, Genzano di Roma, Italy) at 37 °C for 30 minutes at 37 °C. Serum and LV-Luc mixture was added to VERO E6 cells, seeded in 96-well Black Viewplate (Perkin-Elmer, Groningen, the Netherlands) at a density of 2.2 × 104 cells/well. Cells-only and virus-only wells were included for each plate, as controls. Plates were incubated for 48 h at 37 °C. Luciferase expression was evaluated by adding 100ul of the Britelite Plus reagent (Britelite Reporter Gene Assay System, PerkinElmer) and RLU were measured with a Varioskan luminometer (Thermo Fisher). Results are expressed as inhibitory dilution (ID) 50 corresponding to the serum dilution giving 50% inhibition of infection (neutralization) compared to the virus-only control wells after background subtraction in cell control wells. ID50 was calculated with a linear interpolation method66 (link),67 (link).
9
Measuring ATP Levels in Drosophila Pupae
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Assays were performed with the Enlighten ATP Bioluminescence Kit (Promega) according to the manufacturer’s protocols. Briefly, pupae aged 18 hr after puparium formation (APF) were collected, and ground in 100 µl of homogenization buffer (five animals per sample); 20 µl was removed for Bradford Protein Assays (Sigma), and the rest of each sample was boiled 5 min and spun 3 min at 14,000 rpm to remove debris. The supernatant was diluted 1:1000× with ATP-free water, and 10 µl aliquots were mixed with 100 µl rL/L reagent in white 96-well plates, and read immediately on a Varioskan Luminometer (Thermo Scientific), along with a freshly prepared ATP standard series. Three replicates were assayed for each sample, and three readings were conducted for each experiment. ATP concentration was determined by comparison to the ATP standard curve, and normalized to total protein.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!