Sixty-six females (22 individuals randomly selected from each of the three days of indoor collection) which laid eggs successfully were dissected, and the heads/thoraces separated from the abdomens immediately, as explained above. The presence of sporozoite was investigated using a TaqMan genotyping protocol, established by Bass and colleagues [33 (link)]. Real-time PCR MX 3005 (Agilent, Santa Clara, CA, USA) was used for the amplification. A total of 1 μL of gDNA, extracted from each female head/thorax, was used for PCR, with an initial denaturation at 95 °C for 10 min, followed by 40 cycles each of 15 s at 95 °C and 1 min at 60 °C. Primers described by Bass (PlasF_GCTTAGTTACGATTAATAGGAGTAGCTTG and PlasR_GAAAATCTAAGAATTTCACCTCTGACA) were used, together with two probes labelled with fluorophores, FAM (Falcip+_TCTGAATACGAATGTC) to detect Plasmodium falciparum, and HEX (OVM+_CTGAATACAAATGCC) to detect the combination of P. ovale, P. vivax and P. malariae. Positive controls (known FAM+ and OVM+) were used, in addition to a negative control, in which 1 μL of ddH2O was added. To validate findings of the TaqMan assay, a nested PCR of Snounou et al. [34 (link)] was carried out, using all the samples that tested positive with TaqMan. The sporozoite rate was calculated as the percentage of females positive, relative to the total number of the females examined [30 ].
Mx 3005
Manufactured by Agilent Technologies
Sourced in United States
The MX 3005 is a compact, high-performance microplate reader designed for a wide range of applications in life science research and drug discovery. It features a sensitive optical system, flexible filter configuration, and user-friendly software to enable accurate and reliable data acquisition.
Automatically generated - may contain errors
Lab products found in correlation
Mxpro software, by Agilent Technologies (2 mentions)
Superscript 3, by Thermo Fisher Scientific (2 mentions)
Mx3000, by Agilent Technologies (2 mentions)
Oligo dt, by Thermo Fisher Scientific (1 mentions)
Oligo dt 20, by Thermo Fisher Scientific (1 mentions)
Brilliant 3 sybr qpcr master mix, by Agilent Technologies (1 mentions)
Epics xl cytometer, by Beckman Coulter (1 mentions)
Gotaq 1 step rt qpcr kit, by Promega (1 mentions)
Sypro orange, by Merck Group (1 mentions)
21 protocols using mx 3005
1
Molecular Detection of Plasmodium Sporozoites
2
Detecting Malarial Parasites via Real-Time PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sporozoite infection rate was determined using the TaqMan assay described by [17 (link)]. The real-time PCR MX 3005 (Agilent, Santa) system was used for amplification. 1 μl of gDNA for each sample was used as a template in a 3-step program, with a denaturation at 95°C for 10 mins, followed by 40 cycles of 15 sec at 95°C and 1 min at 60°C. Primers described by [17 (link)] were used together with two probes labelled with fluorophores, FAM to detect Plasmodium falciparum, and HEX to detect P. ovale, P. vivax and P. malariae. Two P. falciparum samples and a mix of P. ovale, P. vivax and P. malariae were used as positive controls.
A nested PCR was performed for all the positive samples to validate the TaqMan assay. Two amplification reactions were carried out using cycling parameters of; 95°C for 5 min, 25 cycles of: 94°C for 30 sec, 58°C for 2 min, 72°C for 2 min, final extension at 72°C for 5 min. Primers rPLU 5, rPLU 6 were used during the first amplification reaction and P.fal1, P.fal2 were used for the second amplification reaction as described by [18 (link)].
A nested PCR was performed for all the positive samples to validate the TaqMan assay. Two amplification reactions were carried out using cycling parameters of; 95°C for 5 min, 25 cycles of: 94°C for 30 sec, 58°C for 2 min, 72°C for 2 min, final extension at 72°C for 5 min. Primers rPLU 5, rPLU 6 were used during the first amplification reaction and P.fal1, P.fal2 were used for the second amplification reaction as described by [18 (link)].
3
Plasmodium Detection in Anopheles coluzzii
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA from 93 female An. coluzzii collected using PSC were used to detect sporozoite using a TaqMan genotyping assay [20 (link)]. Mosquitoes were stored immediately after collection in a silica gel and DNA extracted within 7 days. To minimize blood contamination heads/thoraces were separated from abdomens at the anterior end of the abdomen [21 (link)]. Real-time PCR MX 3005 (Agilent, Santa Clara, USA) was used for the amplification. 1 μl of gDNA extracted from each head/thorax was used, with an initial denaturation at 95 °C for 10 min, followed by 40 cycles each of 15 s at 95 °C and 1 min at 60 °C. Primers described by Bass [20 (link)] were used together with two probes labelled with fluorophores, FAM to detect Plasmodium falciparum, and HEX to detect combination of Plasmodium ovale, Plasmodium vivax and Plasmodium malariae. Positive controls (known FAM+ and OVM +) were used, in addition to a negative control (1 μl of ddH20). TaqMan assay results were validated using a nested PCR [22 (link)]. This was carried out using all the positive TaqMan samples. Sporozoite rate was calculated as percentage of mosquitoes with sporozoites relative to the total number of the females examined [16 ].
4
TaqMan Genotyping of Insecticide Resistance
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To assess the role of the L119F-GSTe2 in DDT resistance [5 (link)] and the A296S-RDL mutation conferring dieldrin resistance [3 (link), 7 ], a TaqMan genotyping assay for these markers was used. DNA extracts from adult female An. funestus collected indoors (F0) were separately genotyped for the GSTe2 and the Rdlr allelic variants. In addition, female mosquitoes with known DDT susceptibility phenotypes (F1, dead post-exposure), as defined by the standard WHO protocol [30 ] were also screened for GSTe2. Taqman SNP genotyping assays were performed in 10 μl volume containing 1× Sensimix (Bioline), 80× primer/probe mix and 1 μl template DNA. Probes were labelled with two specific fluorophores FAM and HEX, FAM to detect the homozygous resistant genotype, HEX to detect the homozygous susceptible genotype and both FAM and HEX to detect the heterozygous genotype. The assay was performed on an Agilent MX3005 real-time PCR machine with cycling conditions of 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s and 60 °C for 1 min. FAM and HEX fluorescence was captured at the end of each cycle and genotypes called from endpoint fluorescence using the Agilent MXPro software.
5
Plasmodium Infection Prevalence in Anopheles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To establish infection with Plasmodium, 147 An. gambiae s.l. females (82 from N’djamena and 65 from Massakory) that laid eggs were dissected, head/thoraces used for DNA extraction and TaqMan assay [16 (link)], with MX 3005 (Agilent, Santa Clara, USA). 1 μl of gDNA was used for amplification with the following condition: initial denaturation at 95 °C for 10 min, followed by 40 cycles each of 15 s at 95 °C and 1 min at 60 °C. Primers described previously [PlasF_GCTTAGTTACGATTAATAGGAGTAGCTTG and PlasR_GAAAATCTAAGAATTTCACCTCTGACA [16 (link)]] were used together with two probes labelled with fluorophores, FAM (Falcip+_TCTGAATACGAATGTC) to detect Plasmodium falciparum, and HEX (OVM + _CTGAATACAAATGCC) to detect combination of P. ovale, P. vivax and P. malariae. Positive samples (known FAM+ and OVM+) were used as controls, in addition to a negative control to which 1 μl of ddH20 was added. TaqMan assay results were validated using a nested PCR [17 (link)]. Sporozoite rate was calculated as percentage of mosquitoes with sporozoites in comparison to the total number of the females examined [18 ].
6
Detecting Sporozoites in Anopheles coluzzii
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
93 blood fed female An. coluzzii collected indoor using PSC, and 37 females which laid eggs (collected with aspirators) were used to detect sporozoite with a TaqMan genotyping approach previously described24 (link). Real-time PCR MX 3005 (Agilent, Santa Clara, USA) was used for the amplification. 1 μl of gDNA extracted from each female head/thorax was used as a template for PCR, with an initial denaturation at 95 °C for 10 min, followed by 40 cycles each of 15 sec at 95 °C and 1 min at 60 °C. Primers described by Bass24 (link) were used together with two probes labelled with fluorophores, FAM to detect Plasmodium falciparum, and HEX to detect combination of P. ovale, P. vivax and P. malariae. Positive controls (known FAM+ and OVM+) were used in addition to a negative control in which 1 μl of dH20 was added. To validate findings of the TaqMan assay a nested PCR of Snounou and colleagues25 (link) was carried out using all the TaqMan-positive samples. Sporozoite rate was calculated as percentage of mosquitoes with sporozoites relative to the total number of the females examined20 and entomological inoculation rate was estimated from the sporozoite rate and human-biting rate, as previously described26 .
7
Genotyping Insecticide Resistance Mutations
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The presence of the target-site mutations Ace-1, L1014F (kdr-w) and L1014S (kdr-e) was determined in An. gambiae s.s. and An. coluzzii using TaqMan assay according to the protocols previously described [34 ,35 ]. Sequences of primers used are presented in Table S1. Ten μl volume containing 1 × Sensimix (Bioline), 80 × primer/probe mix and 1 μl template DNA were used. Probes were labelled with two specific fluorophores FAM and HEX, FAM to detect the resistant allele, HEX to detect the susceptible allele. The assay was performed on an Agilent MX3005 real-time PCR machine with cycling conditions of 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s and 60 °C for 1 min.
8
Quantitative Real-Time PCR of Mosquito P450 Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA (4 μg) from each biological replicate was reverse transcribed using Oligo dT (Invitrogen) and Superscript III (Invitrogen) according to manufacturers instructions. Quantitative real-time PCR was performed using SYBR Green Supermix III (Applied Biosystems) using an MX3005 and the associated MxPro software (Agilent). Primer Blast (NCBI) [28 (link)] was used to design primer pairs (Additional file 7 : Table S4). Where possible, primers were designed to span an exon junction but this was not possible for six of the P450 genes (CYP325A1, CYP6P3, CYP4G17, CYP6Z3, CYP12F2 and CYP6Z2) due to the high degree of polymorphisms in their DNA sequence. Each 20 μl reaction contained 10 μl SYBR Green Supermix, 0.3 μM of each primer and 1 μl of 1:10 diluted cDNA. Standard curves were produced using whole N’Gousso cDNA, in 1, 1:5, 1:25, 1:125 dilutions, (48.3 ng/μl to 0.386 ng/μl). qPCR was performed with the following conditions: 3 minutes at 95°C, with 40 cycles of 10 seconds at 95°C and 10 seconds at 60°C. All amplification efficiencies of designed primers were within acceptable range (90-120%), following MIQE guidelines [29 (link)].
9
Molecular Genotyping of G119S ace-1 Mutation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To detect the G119S ace-1R mutation implicated in carbamate and organophosphate resistance [24 (link)] 10 bendiocarb-alive and 10 dead females from Massakory were genotyped. TaqMan assay protocol was as described for detection of the insensitive acetylcholinesterase (iAChE) [31 (link)]. 10 μl comprise of 1× Sensimix (Bioline), 80× primer/probe mix and 1 μl DNA were prepared for each sample. The probes were labelled with specific fluorophores: FAM to detect the mutant allele (S119), and HEX, to detect the susceptible allele (G119). Assay was performed using Agilent MX3005 real-time PCR machine with cycling conditions of 95 °C for 10 min, followed by 40 cycles each of 95 °C for 15 s and 60 °C for 1 min. In addition, four controls were used: (i) DNA from fully susceptible female An. coluzzii (Ngoussou colony); (ii) DNA from fully susceptible An. gambiae s.s. female (Kisumu colony); (iii) DNA from a susceptible female (SS-ace-1) of Central African Republic Origin [32 (link)]; and a negative control (1 μl of ddH2O).
10
Genotyping Organophosphate Resistance in Anopheles gambiae
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The G119S ace-1 responsible to organophosphate and carbamate resistance in An. gambiae s.l. was genotyped in Mibellon mosquitoes. Ten μl volume containing 1 × Sensimix (Bioline), 80 × primer/probe mix and 1 μl template DNA. Probes were labelled with two specific fluorophores FAM and HEX, FAM to detect the resistant allele, HEX to detect the susceptible allele. The assay was performed on an Agilent MX3005 real-time PCR machine with cycling conditions of 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s and 60 °C for 1 min.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!