3500 series genetic analyzer

The Cg-BigDef5 gene was PCR-amplified using specific primers (Fw: 5′-AATCAAGTCAACATGAACAG-3′; Rv: 5′-TTATCCTAGATTTCTAGGTC-3′) based on a transcript sequence previously found in publicly available databases [24 (link)], cloned into a pGEM-T Easy vector (Promega) and then sequenced using the Sanger dideoxy methodology (Applied Biosystems 3500 Series Genetic Analyzer). Exon–intron boundaries were defined by the alignment of cDNA and genomic sequences. Nucleotide sequences were manually inspected and translated using the ExPASy Translate Tool http://web.expasy.org/translate/ (accessed on 1 September 2022). Prediction of signal peptides and other posttranslational processing was carried out using the ProP 1.0 server https://services.healthtech.dtu.dk/service.php?ProP-1.0 (accessed on 1 September 2022), while the theoretical isoelectric point (pI) and molecular weight (MW) of the mature peptides were calculated using the Expasy ProtParam Tool http://web.expasy.org/protparam/ (accessed on 1 September 2022). Multiple alignments of amino acid sequences were generated using MUSCLE with default parameters https://www.ebi.ac.uk/Tools/msa/muscle/ (accessed on 1 September 2022).

To provide genetic evidence of thelytoky, 33 queens (from 17 nests of seven populations; all used in the rearing experiment) were examined (Table 5). They were genotyped at microsatellite locus Mp-1 (f: GCCAATGGTTTAATCCCTCA; r: TCATACTGCGTGTGCCTTTC), originally developed from M. pharaonis [24 ]. Daughter workers produced from these virgin queens (174 individuals in total) were also genotyped and were compared with their mothers. The thorax of each individual was crushed and placed in a 0.2-mL microtube filled with 100 μL of a DNA extraction reagent (PrepMan Ultra Reagent, Applied Biosystems, Foster City, CA, USA). The polymerase chain reaction (PCR) cocktail contained 1 μL of template DNA, 0.3 μL of 25 mM MgCl₂, 0.3 μL of 10 mM dNTPs, 1.5 μL of 10× PCR Buffer, 0.1 μL of 5 U/μL Taq DNA Polymerase (QIAGEN, Valencia, CA, USA), 0.2 μL of U19 fluorescent dye, and 1.0 μL of each primer pair, to which distilled water was added to make a total volume of 15.2 μL. The PCR program consisted of an initial step of 94°C for 180 s, followed by 35 cycles of 94°C for 30 s, 57°C for 60 s and 72°C for 60 s, with a final step of 72°C for 10 min. PCR products were mixed with Hi-Di formamide and GS-600 LIZ size standard and were analyzed by using a 3500 Series Genetic Analyzer and GeneMapper 5.0 software (Applied Biosystems).

The complete sequencing of the 16S rRNA gene was performed using the MicroSEQ™ Full Gene 16S rDNA kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. The sequences were obtained using the 3500 Series Genetic Analyzer (Applied Biosystems, Waltham, MA, USA) and were processed using DNA Star LaserGene SeqMan software, version 7.0.0. The identification results were obtained from the website https://www.ezbiocloud.net/ (database update: 23 August 2023; last access: 23 November 2023) [12 (link)]. All sequences were deposited at https://www.ncbi.nlm.nih.gov/ (database update: 29 December 2023), and accession numbers are provided in Table 2. Complete 16S rRNA gene sequencing results were considered valid when the identification percentage was ≥96%. When the identification was ≥98.7%, the strain was considered identified at the species level [13 (link)].
Phylogenetic analysis was conducted through the alignment of the sequences obtained by sequencing the 16S rRNA gene using BioEdit Sequence Alignment Editor software, version 7.0.5.3 [14 ]. MEGA 11, software version 11.0.13 [12 (link)], was used to construct maximum likelihood trees, employing the Kimura-2 parameter model with branching support based on 1000 bootstrap replicates.

For isolation of genomic DNA, yeast cell cultures were grown overnight at 30° in Yeast Extract–Peptone–Dextrose (YPD) broth to an early stationary phase before cells were harvested by centrifugation. Total genomic DNA was then extracted using E.Z.N.A.^® Yeast DNA Kit (Omega Bio-Tek Inc., Norcross, GA, USA) according to the manufacturer’s instructions. Extracted DNA was subjected to two PCR assays for amplification of the internal transcribed spacer (ITS) and D1/D2 ribosomal DNA regions [23 ,24 (link)]. The PCR protocols were performed using the primers ITS1-ITS4 and NL1-NL4, respectively (1.25 μL of each M13-tailed primer 10 pMol/μL) and the 1X KAPA HiFi Hot Start Ready Mix (Roche, Basel, Switzerland) kit. Then, 5 μL of DNA was added for the final volume of 25 μL. PCR started with an initial denaturation step of 3 min at 95 °C, followed by 35 cycles of 15 s at 95 °C, 15 s at 50 °C, 5 s at 72 °C and a final extension at 72 °C for 3 min. PCR products were purified using an enzymatic clean-up Exo-SAP-ITTM kit. Amplicons were Sanger sequenced on a 3500 Series Genetic Analyzer with BigDye Terminator chemistry (Applied Biosystems, Bedford, MA, USA) using M13-tailed primers. Sequence data analysis and trimming were performed using Geneious Prime software (version 2022 2.2). The resulting sequences were compared by BLAST analysis for isolate identification.

Tested samples were extracted from a variety of sources by Chelex^®100 (BIORAD, Richmond, CA, USA) (10 (link)), QIAamp DNA Micro Kit (Qiagen, GmbH, Hilden, Germany) (11 ) and Phenol-Chloroform extraction (12 (link)).
The detection was performed on an Applied Biosystems® 3500 Series Genetic Analyzer and data were analyzed with GeneMapper® ID-X software.

HEK293, HeLa, NIH/3T3 and U‐2 OS cells were purchased from the American Type Culture Collection (Manassas, VA, USA) and maintained in Dulbecco's modified eagle medium, supplemented with 10% FBS in a 37°C humidified incubator containing 5% CO₂. Established human cell lines used in this study were short tandem repeat (STR) profiled using AmpFlSTR Identifiler^® Plus PCR Amplification Kit (ThermoFisher Scientific, Waltham, MA, USA) with the Applied Biosystems 3500 Series Genetic Analyzer and analysed by GeneMapper^® Software 5 (Applied Biosystems, Foster City, CA, USA). The STR profile of all cells lines showed >88% concordance with their reference profile in the ATCC cell line database.