Weaned (3-week-old) male C57Bl/6 mice (n = 10) were purchased from the Animal Resources Centre, Murdoc, WA, Australia1 and acclimatised for 1 week to adapt in new environment prior to start injection. Mice were housed (maximum of 3 mice per cage) in ventilated GM500 cages (Tecniplast, Buguggiate, VA, Italy) in the local animal care facility (School of Medicine, Western Sydney University). Standard rodent pellet chow (Gordon’s Specialty Stockfeeds, Yanderra, NSW, Australia) and water were available ad libitum. Basic enrichments such as nesting crinkle material and polyvinyl chloride pipe tube were provided. Mice were maintained in a temperature controlled environment throughout the entire period as previously described (Sen et al., 2019 (link)). At 4 weeks of age, mice (n = 5) were injected with 40 mg/kg Minocycline (Sigma-Aldrich, St Lucia, MO, United States dissolved in distilled water) intraperitoneally (29G syringe, erumo, Elkton, MD, United States) each day for five days at a similar time (10–11 am). No placebo or saline injections were used for control mice (n = 5). Mice were weighed every day to monitor general health. No abnormality in body condition, posture and injury were found following injections. On the 6th day mice were overdosed using intraperitoneal sodium pentabarbitone injection (250 mg/kg, LethobarbTM, Tory laboratories, Glendenning, NSW, Australia).
Gm500 cage
Manufactured by Tecniplast
Sourced in Italy
The GM500 cages are laboratory equipment designed for housing small laboratory animals. The cages provide a controlled environment for the animals and facilitate their care and observation.
Automatically generated - may contain errors
Lab products found in correlation
10 protocols using gm500 cage
1
Minocycline Injection in Mice
2
Mustn1 Knockout Mouse Model
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All animal experiments were approved by the regional animal ethics committee of Northern Stockholm, Sweden (Permits 4039-2018 and 4359-2020 to Jorge Ruas). All mice were housed at ca. 22 °C on a 12-hour light/dark cycle. Unless otherwise stated, mice were housed in groups of 3–5 per cage (GM500 cages, Tecniplast), with free access to water and food (Special Diet Services CRM-P). Wildtype mice (C57BL/6N and C57BL/6J) were obtained from Janvier Labs. Mustn1 KO-first mice (C57BL/6N-Atm1Brd Mustn1tm1a(EUCOMM)Wtsi/BayMmucd) were obtained from MMRRC (ref. 041556-UCD) and negatively selected against the tyrosinase albino (Tyrc) allele. Intercrossing of Mustn1+/tm1a mice produced viable offspring at expected Mendelian ratio (analyzed offspring, n = 95; Mustn1+/+, n = 22 (23.16%), Mustn1+/tm1a, n = 48 (50.53%) and Mustn1tm1a/tm1a, n = 25 (26.32%)). Myog-Cre mice were obtained from Dr. Eric Olson (UT Southwestern) [19 (link)]. Actb-Cre and Flp deleter mice (C57BL/6N-Tg(ACTB-FLP)Dym) were a kind gift from Dr. Nils-Göran Larsson (Karolinska Institutet, Sweden). All mice were maintained on a C57BL/6N background and heterozygous male and female mice were bred for experimental cohorts, unless otherwise stated.
3
Housing and Care of NMRI Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used NMRI mouse line. Mice were kept in SPF cages 40 × 25 × 15 cm under standard laboratory conditions: a 12 h light circuit, 22 °C. Animals had free access to food and water. For housing, individually ventilated GM500 cages manufactured by Tecniplast (Italy) with a floor area of 500 cm2 were used. In the nests, the harem type of housing (2 females + 1 male) was carried out34 (link). All animals were housing with littermates of the same sex in a group of 2–5 mice. All animal care and use protocols were conducted in accordance with the Standards of Humane Care and Use of Laboratory Animals of the Institute of Cell Biophysics, Puschino, Russia. All experiments involving animals also complied with the Guidelines for the Proper Conduct of Animal Experiments of the Bioethics Committee of the Institute of Cell Biophysics and Russian Federation National Ministry of Public Health (Act708n, 23 August 2010), and the ARRIVE guidelines for reporting animal research.
4
Genetic Manipulation of Mouse CDHR5
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All the mouse experiments were performed in accordance with Austrian and European laws and with the general regulations specified by the Good Scientific Practice guidelines of the Medical University of Vienna (BMWFW‐66.009/0189‐WF/V/3b/2015 & 2020‐0.448.823). Mice were housed in the animal facility of the Medical University of Vienna (https://biomed‐forschung.meduniwien.ac.at ) at constant room temperature, with 12 h light/12 h dark cycles and under specific pathogen free (SPF) conditions. They received a standard diet (LASQC diet, Rod16, Auto from Altromin) and drinking water at libitum and were housed in ventilated GM500 cages (Tecniplast) with standard wood chips. Sex‐ and age‐matched littermates (6–9 weeks old) of CDHR5+/+, CDHR5+/∆, and CDHR5∆/∆ mice in the C57BL/6 genetic background were used for experiments. Genotyping was performed with toe DNA using primers P1 5′‐CCAGACAGCCTCACACAGAA‐3′, P2 5′‐GTTGCTCATGGTGAAGCAGA‐3′ and P3 5′‐GACACGCTGAACTTGTGGCCGTTTA‐3′ resulting in 261 bp amplicons of CDHR5 wildtype alleles and 528 bp amplicons of deleted alleles.
5
Heterotopic SKBR3 Xenografts in Nude Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Six-week-old female Balb/c nude mice were purchased from Janvier Laboratories (Le Genest Saint Isle, France). Animals were maintained under a controlled environment (20 ± 2 °C) with a relative humidity of 50 ± 10% and a 12 h/12 h light-dark cycle in ventilated GM500 cages (Techniplast, Milan, Italy). The bedding consisted of wood chips (Safe® SF14, Safe laboratories, Augy, France) and cages were enriched with mouse house and nestlets pads. Food (autoclavable diet, Safe® DO4, Safe laboratories, Augy, France), and tap water was available ad libitum. For heterotopic xenografts of SKBR3 cells, 5 × 106 cancer cells were resuspended in 50% DMEM + 50% Matrigel® HC (Corning, 354248) and were implanted subcutaneously into the flank of healthy 7-week-old female mice. Nine weeks after SKBR3 cell xenografts, mice were randomised based on tumour volume to obtain three homogenous groups then treated on day 0 (first treatment) and 9 via intravenous route with vehicle (HBG) or 1.8 nmol/kg of ATNP or cNP. Body weight monitoring is reported in Figure S10 .
6
Breast Cancer Xenograft Growth in Nude Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The animal experiments were performed in accordance with the protocols approved by the Animal Ethics Committee of the University of Western Australia (RA/3/100/1159 and RA/3/100/1687). Five-week-old female BALB/cJ Foxn1nu/Arc (Nude mice) were obtained from the Animal Resources Centre (Canning Vale, Australia) and used for the breast cancer xenograft growth study. All animals received adequate environment enrichment, which includes housing with other animals where possible. Mice were housed in Techniplast GM500 cages (30 cm × 16.7 cm × 13.5 cm) (n = 4/cage) on a coarse aspen bedding with a paper towel, a tissue, a cotton nestlet, and an aspen gnawing block for enrichment. Room temperature and humidity was maintained at 22.5 °C and between 30% and 70%, respectively. All mice were held under 12:12 (12-h light:12-h dark) with light increasing gradually in both the morning and evening. The mice were randomly assigned to the different experimental groups.
7
Aortic Dilation Protocol in Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
Male C57BL6/J mice were purchased from Charles River (
https://www.criver.com , United Kingdom) and used for experiments at 12 weeks of age. Animals were housed in GM500 cages (Techniplast, Italy) with a 12-hour light/dark cycle and free access to standard chow diet and triple-filtered drinking water. Each cage contained a dome home and chew sticks as environmental enrichment. The animals were housed at a maximum of five per cage.
Midline laparotomy was performed under recovery isofluorane anesthesia and the aorta exposed using blunt dissection and PPE or saline applied to the aorta for 5 minutes, as described by Bhamidipati et al.
2 (link)
The peritoneal cavity was washed out three times with normal saline and the abdominal wall closed in layers with Vicryl sutures. Two independent cohorts of mice (cohort A and cohort B) were used in this study. Cohort A was used to assess observer variability in USS measurements. Cohort B was used to assess single APd
max/3D USS measurement sensitivity in detection of aortic dilation.
Animal work was performed in accordance with the UK Animals, Scientific Procedures Act 1986. This study was performed under existing institutional approval (the Home Office Project License PPL: P606320FB). All investigators undertook additional training to obtain Home Office personal animal licenses.
+ Expand
Male C57BL6/J mice were purchased from Charles River (
Midline laparotomy was performed under recovery isofluorane anesthesia and the aorta exposed using blunt dissection and PPE or saline applied to the aorta for 5 minutes, as described by Bhamidipati et al.
2 (link)
The peritoneal cavity was washed out three times with normal saline and the abdominal wall closed in layers with Vicryl sutures. Two independent cohorts of mice (cohort A and cohort B) were used in this study. Cohort A was used to assess observer variability in USS measurements. Cohort B was used to assess single APd
max/3D USS measurement sensitivity in detection of aortic dilation.
Animal work was performed in accordance with the UK Animals, Scientific Procedures Act 1986. This study was performed under existing institutional approval (the Home Office Project License PPL: P606320FB). All investigators undertook additional training to obtain Home Office personal animal licenses.
8
Transgenic Mouse Models for Inflammation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C57BL/6N mice were used in all experiments except for the transgene mice and their wild-type controls, which were on a C57BL/6J background. Transgene mice: Ncr1iCre mice [Ncr1tm1.1(icre)Viv] were provided by Vivier and coworkers (44 (link)) and crossed with ROSA26–flox-stop-flox-tdTomato mice [B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J] to create Ncr1-tdTomato mice, Rag2−/−OTI [B6.129S6-Rag2tm1Fwa Tg(TcraTcrb)1100Mjb], and Rag2−/−Il2rg−/− mice (C;129S4-Rag2tm1.1Flv Il2rgtm1.1Flv/J). Purchased time-mated pregnant females were bought from Janvier. All transgene mice were bred and kept in-house at the VIB Center for Inflammation Research under specific pathogen-free conditions. All mice were kept in individually ventilated GM500 cages (Techniplast) with a 14/10-hour light/dark cycle in a temperature-controlled (21°C) room. Mice were provided water and food ad libitum. All mouse experiments were conducted according to institutional, national, and European animal regulations. Ghent University’s Ethics Committee approved all experimental animal procedures. Experiments were conducted in agreement with the European Parliament’s Directive 2010/63/EU and the 22-09-2010 Council on the protection of animals used for scientific purposes.
9
Cuprizone-Induced Demyelination in Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Adult (7-week old) male C57Bl/6 mice (n = 20) were purchased from the Animal Resources Centre, Australia (www.arc.wa.gov.au ). Mice were acclimatized for 1 week and housed (2 animals/ventilated GM500 cage, Tecniplast, Italy) in a controlled environment (12-h light/dark cycle, 50–60% humidity and 21–23 °C) in the animal facility (School of Medicine, Western Sydney University). Standard rodent powder chow (Gordon’s Specialty Stockfeed, Australia) and water were available ad libitum.
Age-/weight-matched mice were randomly divided into control (Ctrl) or CPZ groups (n = 10 mice/group). CPZ (Sigma-Aldrich, St. Louis, MO, USA; 0.1% w/w) was mixed with powdered chow and fed to mice for 12 weeks to induce a slow progressive oligodendrocytosis and demyelination (i.e. more reminiscent of MS (Sen et al. 2020a (link))). The powdered chow was prepared daily without (for Ctrl group) and with CPZ and provided in excess (ad libitum) in a single shared feeder per cage. At the end of 12 weeks, all mice were euthanized for histological and proteomic analyses.
Age-/weight-matched mice were randomly divided into control (Ctrl) or CPZ groups (n = 10 mice/group). CPZ (Sigma-Aldrich, St. Louis, MO, USA; 0.1% w/w) was mixed with powdered chow and fed to mice for 12 weeks to induce a slow progressive oligodendrocytosis and demyelination (i.e. more reminiscent of MS (Sen et al. 2020a (link))). The powdered chow was prepared daily without (for Ctrl group) and with CPZ and provided in excess (ad libitum) in a single shared feeder per cage. At the end of 12 weeks, all mice were euthanized for histological and proteomic analyses.
10
Acclimatization and Care of C57Bl/6 Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Weaned (3-week-old) male and/or female C57Bl/6 mice (n = 187) were purchased from the Animal Resources Centre, Murdoch, WA, Australia1 . Mice were acclimatized for 1 week prior to each study and housed (five animals/ventilated GM500 cage, Tecniplast, Buguggiate, VA, Italy) in a controlled environment (12-h light/dark cycle, 50–60% humidity, and 21–23°C room temperature, RT). Standard rodent powder chow (Gordon’s Specialty Stockfeeds, Yanderra, NSW, Australia) and water were available ad libitum. Mice were weighed individually at the beginning of the studies, every third day, and prior to sacrifice. Research and animal care procedures were approved by the Western Sydney University animal ethics committee (A11938) in accordance with the Australian Code of Practice for the Care and Use of Animals for Scientific Purposes as laid out by the National Health and Medical Research Council of Australia.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!