Genejet pcr cleanup kit

Manufactured by Thermo Fisher Scientific

Sourced in Germany

The GeneJet PCR Cleanup kit is a laboratory product designed to purify PCR amplified DNA fragments. It efficiently removes unwanted primers, nucleotides, and other impurities from PCR reactions, allowing for the recovery of high-quality DNA samples for downstream applications.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

PCR Cleanup Kit GeneJET kit

3 protocols using genejet pcr cleanup kit

DNA Templates for Transcription Obstacle AFM

Check if the same lab product or an alternative is used in the 5 most similar protocols

The DNA templates used for AFM measurements of transcription through 186 CI obstacles were 1510 bp in length and were produced by PCR using plasmid template pT7A1_pRpL-FR (see supplementary information), with an unlabeled forward primer (5’-AGCCATGACCCAGTCAC) and a 5’-biotin-labeled reverse primer (5’-GCACTCTCAGTACAATCTGCTCTG). PCR products were purified using a GeneJet PCR Cleanup kit (Thermo Scientific, Waltham, MA). From the forward primer the fragments contained the T7A1 promoter with a transcription start site 167 bp, followed by the three 186 pR/pL binding sites 271 bp further, the FR site at 391 bp beyond that, a λt1 terminator at 551 bp beyond FR (Figure 1A), and 129 bp to the downstream end.
The DNA templates used for AFM measurements of transcription through λ CI obstacles were 1737 bp in length and were produced by PCR using plasmid template pDK_LMB_400 (see supplementary information), with unlabeled forward (5’- CTTGTCTGTAAGCGGATGCC) and reverse (5’- ACGCAAACCGCCTCTCC) primers and purified using a GeneJet PCR Cleanup kit (Thermo Scientific, Waltham, MA). From the forward primer the templates contained the T7A1 promoter with a transcription start site 128 bp, followed by the OL region 261 bp further, the OR region 451 bp beyond that, and finally a λt1 terminator at 678 bp beyond OR, and 218 bp to the downstream end.

Lu Y., Voros Z., Borjas G., Hendrickson C., Shearwin K., Dunlap D, & Finzi L. (2022). RNA polymerase efficiently transcribes through DNA-scaffolded, cooperative bacteriophage repressor complexes. FEBS letters, 596(16), 1994-2006.

+ Open protocol

+ Expand

Transcription Dynamics Through DNA Obstacles

Check if the same lab product or an alternative is used in the 5 most similar protocols

The DNA templates used for AFM measurements of transcription through 186 CI obstacles were 1510 bp in length and were produced by PCR using plasmid template pT7A1_pRpL-FR (see supplementary information), with an unlabeled forward primer (5'-AGCCATGACCCAGTCAC) and a 5'-biotin-labeled reverse primer (5'-GCACTCTCAGTACAATCTGCTCTG). PCR products were purified using a GeneJet PCR Cleanup kit (Thermo Scientific, Waltham, MA). From the forward primer the fragments contained the T7A1 promoter with a transcription start site 167 bp, followed by the three 186 pR/pL binding sites 271 bp further, the FR site at 391 bp beyond that, and finally a λt1 terminator at 551 bp beyond FR (Figure 1A). The DNA templates used for AFM measurements of transcription through λ CI obstacles were 1737 bp in length and were produced by PCR using plasmid template pDK_LMB_400 (see supplementary information), with unlabeled forward (5'-CTTGTCTGTAAGCGGATGCC) and reverse (5'-ACGCAAACCGCCTCTCC) primers and purified using a GeneJet PCR Cleanup kit (Thermo Scientific, Waltham, MA). From the forward primer the templates contained the T7A1 promoter with a transcription start site 128 bp, followed by the OL region 261 bp further, the OR region 451 bp beyond that, and finally a λt1 terminator at 678 bp beyond OR (see supplementary information).

Lü Y., Vörös Z., Borjas G., Hendrickson C., Shearwin K.E., Dunlap D., & Finzi L. (2021). Transcription disrupts DNA-scaffolded bacteriophage repressor complexes.

+ Open protocol

+ Expand

Amplification and Sequencing of pfhrp2/3 Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Amplifications of exons 2 and their flanking regions of pfhrp2/3 genes were done by semi-nested PCR [22 (link)] using published protocols and primers (Table 1). Nest-1 PCR targets repeat sequences within the most variable part of the genes while the second primer set targets an intron region. For pfhrp2, PCR nest-1 product sizes of 720–830 bp were expected while for Pfhrp3, the expected PCR product size was< 500 bp. The PCR products were purified by the GeneJet PCR Cleanup Kit from Thermo Fisher Scientific and sent for sequence determination at Eurofins genomics, Germany. Sequences were analysed by the 4peaks program (A. Griekspoor and Tom Groothuis, nucleobytes.com).

Golassa L., Messele A., Amambua-Ngwa A, & Swedberg G. (2020). High prevalence and extended deletions in Plasmodium falciparum hrp2/3 genomic loci in Ethiopia. PLoS ONE, 15(11), e0241807.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!