On target smartpool

For E3 knockdown, Flp-In293 cells seeded in 12-well plates were transfected with pooled siRNAs (100 nM, ON-TARGET SMARTpool, Dharmacon) using Dharmafect1 (Dharmacon) at a ratio of 1:4 according to the manufacturer’s instructions. Cells were expanded 24 hr post-transfection and harvested following another incubation of 24 hr. For knockdown of RNF26 and its associated interactors, Flp-In293 cell lines seeded in 12-well plates were transfected with individual siRNAs (50 nM, Sigma, Supplementary file 1, Table 11) using Lipofectamine RNAiMax (Thermo Fischer Scientific) at a ratio of 1:4 according to the manufacturer’s instructions. Cells were expanded 24 hr post-transfection and harvested following another incubation of 24 hr. RNF26 knockdown was confirmed by qRT-PCR (RNF26_F: GAATCCCCTCCTACCCCTGT, RNF26_R: GAGGAGAGCCCACAGCAAAT, Actin_F: GAGGCACTCTTCCAGCCTT, Actin_R: AAGGTAGTTTCGTGGATGCC), while interactor knockdowns were confirmed by western blot.

hASCs were plated at 20,000 cells/cm² in antibiotic-free basal medium 24 hours prior to transfection. siRNA transfection was performed following the manufacturer’s protocol as previously described34 (link). Briefly, ON-TARGET SMARTpool siRNAs directed against β-catenin (L-003482-00-0005, Dharmacon, Lafayette, USA) or Non-targeting siRNAs (D-001810-10-05, Dharmacon) were mixed with Transfection DharmaFECT 1 (Dharmacon), respectively. After a 20 minutes incubation at room temperature, the complexes were added to the cells at a final siRNA concentration of 25 nM. The medium was replenished with medium containing antibiotic 24 hours post-transfection. The culture medium was changed every 2 days for the duration of the experiment.

Plasmid transfections were performed using Fugene HD (Roche, Mannheim, Germany). Oligofectamine (Invitrogen) and ON-Target SMARTpool were used for siRNA transfection (Dharmacon, Lafayette, CO). The following siRNA sequences were used to deplete NAV3 expression:

GCUGUUAGCUCAGAUAUUU

CAGGGAGCCUCUAAUUUAA

GAGAGGGUCUUCAGAUGUA

GGACUUAACCUAUAUACUA

shRNA-hairpins against NAV3 were from Open Biosystems (Thermo Fisher Scientific, Huntsville, AL) and produced in HEK-293T cells. Cells were infected with shRNA-encoding lentiviruses with polybrene (8 μg/ml) and cultured for 4 days in the presence of puromycin (2 μg/ml), prior to RNA extraction and real-time PCR. The following shRNA sequence was used to downregulate NAV3 expression:
5′-CCGG-GCCTTGTGAATAGATCGCTTT-CTCGAG AAAGCGATCTATTCACAAGGC-TTTTTG-3′.

hASCs were plated in growth medium 24 h prior to transfection. The siRNA transfection was performed following the manufacturer’s protocol as previously described [56 (link)]. Briefly, ON-TARGET SMARTpool siRNAs directed against human α5 integrin (L-008003-00-0005, Dharmacon, Lafayette, LA, USA) or non-targeting siRNAs (D-001810-10-05, Dharmacon) were mixed with Transfection DharmaFECT1 (Dharmacon). After a 20-min incubation at room temperature, the complexes were added to the cells at a final siRNA concentration of 50 nM. The medium was replenished with fresh medium for 24 h post-transfection. Experiments were performed 48–72 h after transfection.

Cells were transfected with MCL1-directed siRNA (ON-TARGET SMARTpool) or non-targeting siRNA (NON-TARGETING pool) purchased from Dharmacon (Chicago, IL, USA) using Trans-IT siQuest transfection reagent (Mirus, Madison, WI, USA) according to the manufacturer’s protocol. The cells were further treated or analyzed after overnight transfection.