Allstar sirna

MCF7 and MDA‐MB‐231 cells were purchased from ATCC and cultured in RPMI 1640 medium and Dulbecco's modified Eagle's medium (DMEM), respectively, with 10% FBS both from Life Technologies (Grand Island, NY). WT and Cas2−/− MEFs were a kind gift from D. Green (St. Jude's Children Hospital) and cultured in DMEM with 10% FBS both from Life Technologies (Grand Island, NY, USA). Before all doxorubicin treatments, the media were changed on cells to fresh new media. Gene silencing was then carried out using siRNA directed against human SK1 (target sequence 5′‐AAGGGCAAGGCCTTGCAGCTC‐3) and all‐star siRNA as a negative control purchased from Qiagen. The siRNA directed against CHK1 and p53 were validated predesigned sequences from Invitrogen. Transfections were carried out using Lipofectamine^® RNAiMAX from Life Technologies (according to the manufacturer's protocol). For siRNA experiments, cells were seeded into 60‐mm plates at < 75 000 cells per dish and treated with 20 nm siRNA for 48 h prior to stimulation.

siRNAs used in this study were generated by Sigma-Aldrich and target the following sequences:
As a negative control, Allstar siRNA (Qiagen) was used. HeLa cells were seeded and simultaneously reverse transfected with 100 nM siRNA using Lipofectamine RNAi MAX (Thermo Fisher Scientific) and OPTI-MEM (Gibco) and incubated for at least 48 hrs prior to infection or biochemical assays.

HeLa cells were grown in HyClone DMEM/High Glucose media supplemented with 10% FBS. Mouse primary kidney cell line, 68J or 208EE (Lentz et al, 2013), was established from an adult C57BL/6 mouse kidney. For RNAi experiments, HeLa cells were transfected with siRNA (50 nM final concentrations) using Invitrogen Lipofectamine 2000 Reagent (Life Technologies, Carlsbad, CA) according to the manufacturer protocol and as described in previous studies (Wee et al, 2014). Scrambled AllStar siRNA (Qiagen) was used as a control. Cells were grown for 48 h post‐transfection, at which point cells were transfected with an additional 50 nM siRNA. Cells were then split 1:2, 24 h after the second RNAi treatment, and total RNA and protein were collected 24 h later. siRNA sequences are provided in Appendix Table S1. For ASO experiment, ASOs (80 nM final concentration) were transfected into human HeLa or mouse kidney‐derived 208EE cells. RNA was collected 48 h post‐transfection.