Thirty- and 120-day-old workers were collected from stable colonies and briefly anesthetized on dry ice. The right antenna was surgically removed at the base of the head using scissors heat-sterilized with a Germinator 500 (Braintree Scientific). As a control, age-matched workers were subjected to the same experimental procedure, including anesthesia, but the antenna was not removed (mock treatment). Thirty minutes after amputation, the ants were returned to their colony. Brains were harvested 3 days after injury, and the two hemispheres were separated. RNA was purified with TRIzol from each hemisphere, and expression of Mmp1 was quantified by RT-qPCR with primers CGCTATCCAGGCCTTGTACG and CCTTGGAGTTGAACATCGCG using Power SYBR Green RNA-to-CT (ThermoFisher Scientific). Rpl32 was used as a reference gene (4 (link)); primer sequences, CGTAGGCGATTTAAGGGTCA and TTTCGGAAGCCAGTTGGTAG.
Power sybr green rna to ct
Manufactured by Thermo Fisher Scientific
Sourced in United States
Power SYBR Green RNA-to-CT is a sensitive and reliable real-time PCR kit designed for the quantification of RNA targets. It includes all the necessary reagents for reverse transcription and quantitative PCR in a single, convenient format.
Automatically generated - may contain errors
Lab products found in correlation
Cfx connect real time system, by Bio-Rad (1 mentions)
Rneasy plus mini kit, by Qiagen (1 mentions)
Fast sybr green master mix, by Thermo Fisher Scientific (1 mentions)
Nanodrop, by Thermo Fisher Scientific (1 mentions)
Magmax pathogen rna dna kit, by Thermo Fisher Scientific (1 mentions)
Bcl 2, by Qiagen (1 mentions)
Bcl xl, by Qiagen (1 mentions)
Viia7 cycler, by Thermo Fisher Scientific (1 mentions)
Bcl2 associated x (bax), by Qiagen (1 mentions)
Igf 1r, by Qiagen (1 mentions)
6 protocols using power sybr green rna to ct
1
Antenna Removal Impacts Mmp1 Expression
2
Quantification of cytokine mRNA levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Purification of RNA was performed using the Qiagen (Valencia, CA, USA) RNeasy Plus Mini Kit cat. #74134. qRT-PCR was performed on RNA using Power SYBR Green RNA-to-CT (ThermoFisher Scientific cat. #4389986, Waltham, MA, USA). All reactions were performed on a CFX Connect Real-Time System (Bio-Rad, Hercules, CA, USA). 5 ng of total cellular RNA was used for each reaction. Primers for β-actin (reference gene), cxcl1 and c-jun were purchased from Qiagen, catalog numbers QT00095242, QT00115647, and QT00296541 respectively. The primers for measuring zak expression were purchased from Integrated DNA Technologies (Coralville, IA, USA) assay ID# Mm.PT.58.31046083. The values for relative copies (mRNA) are based on calculation of ∆∆CT normalized to that from untreated BMDMs from C57BL/6 mice.
3
Quantitative RT-PCR for POWV Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was screened for POWV using a nonclinical quantitative reverse transcription polymerase chain reaction (RT-qPCR) assay targeting the NS5 gene [13 (link)]. Diluted samples (1:4) were tested in triplicate alongside a standard curve and negative controls using Power SYBR Green RNA-to-CT (Applied Biosystems, Foster City, California, USA). The previously published limit of detection for this assay was 10 copies/µL [13 (link)], so samples with >10 copies/µL were considered positive, samples with 1–10 copies/µL equivocal, and samples with <1 copy/µL negative.
4
qPCR and RT-qPCR Protocols for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA templates were mixed with Fast SYBR Green Master Mix (Applied Biosystems), TbAOX primers (10 μM final concentration, fwd: 5′-AAACGGCCTCGTTGATACAC-3′, rev: 5′-TGCTGAGGTTCCAGTACACG-3′) and nuclease-free water in a 96-well PCR plate. qPCR was carried out using the QuantStudio PCR cycler together with the QuantStudio Design and Analysis software. Quantitative reverse-transcriptase PCR was done with Power SYBR Green RNA-to-Ct™ (Applied Biosystems) and primers against TbMSP-B (fwd: 5′-GTGGCTGGCGTAACTAACCT-3′, rev: 5′-TGTGATAATGCGGTGCCACT-3′), tubulin (fwd: 5′-CTCCTCCTCGTCGAACTCGCCCT-3′, rev: 5′-ATGCGCGAAATCGTCTGCGTTCAG-3′) or GAPDH (fwd: 5′-CACAGCCACACAAAAGACCG-3′, rev: 5′-CGCGTCGCAATGAAGGTAAG-3′).
5
Quantification of CMV Nucleic Acid by qPCR
6
Apoptosis Regulation in Megakaryocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative reverse transcription polymerase chain reaction (Q-RTPCR) was performed on RNA from day 11 megakaryocytes (both treated and untreated) using Power SYBR Green RNA-to-CT (Applied Biosystems, Grand Island, NY). The following primers were used: BAK, BAX, BNIP3, BNIP3L, BCL2, BCL-XL, IGF1R, CFLAR (all Qiagen, Germantown, MD). PCR reactions were performed on a Viia7 cycler (Applied Biosystems). The amount of mRNA for each sample was normalized using beta-actin as endogenous control.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!