N-glycan purification and pyridylamination were performed as described previously16 (link)17 (link). PA-N-glycans were analyzed by HPLC using the following columns: DEAE (TSKgel DEAE-5PW, Tosoh, Tokyo, Japan), NP (Shodex Asahipak NH2P-50 4E, Showa Denko, Tokyo, Japan) and RP (CAPCELL PAK C18 SG120, Shiseido, Tokyo, Japan or Develosil C30-UG-5, Nomura Chemical, Seto, Japan). Additional details are provided in the Supplementary Information .
Tskgel deae 5pw
Manufactured by Tosoh
Sourced in Japan
The TSKgel DEAE-5PW is a strong anion exchange chromatography resin for the separation and purification of biomolecules. It features a rigid polymethacrylate matrix with diethylaminoethyl (DEAE) functional groups. This resin is designed for high-performance liquid chromatography (HPLC) applications.
Automatically generated - may contain errors
Lab products found in correlation
Pdrive cloning vector, by Qiagen (2 mentions)
Shodex asahipak nh2p 50 4e, by Resonac (1 mentions)
Prominence lc, by Shimadzu (1 mentions)
Inertsep gc, by GL Sciences (1 mentions)
Shim pack hrc ods column, by Shimadzu (1 mentions)
Blotglyco, by Sumitomo Bakelite (1 mentions)
Lachrom elite hplc system, by Hitachi (1 mentions)
Pngase f, by Promega (1 mentions)
Pgem t easy vector, by Promega (1 mentions)
Neuraminidase derived from arthrobacter ureafaciens, by Nacalai Tesque (1 mentions)
9 protocols using tskgel deae 5pw
1
N-Glycan Purification and Analysis
2
Purification of Native Biglycan Proteoglycan
3
IgG N-Glycan Release and Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Release of N-glycans from IgG sample and subsequent derivatization with 2-aminopyridine was performed using BlotGlyco (Sumitomo Bakelite, Tokyo, Japan) under the manufacturer’s instruction with slight modifications. The released N-glycans and peptides were removed using a graphite carbon column (InertSep GC, GL Sciences, Tokyo, Japan), and free 2-aminopyridine was removed from the reaction mixture using MonoFas I Spin Column (GL Sciences, Tokyo, Japan). The resultant pyridylamino (PA)-glycans were then applied on a LaChrom Elite HPLC system (Hitachi, Tokyo, Japan) under conditions reported previously [10] (link), [11] (link) using a TSKgel DEAE-5PW (7.5 mm×7.5 cm, Tosoh Corporation, Tokyo, Japan) and a Shim-pack HRC-ODS column (6.0 mm×15 cm, Shimadzu, Kyoto, Japan). PA-oligosaccharides were detected by fluorescence using excitation and emission at 320 and 400 nm, respectively. Elution times of the individual peaks from the ODS columns were normalized with respect to the PA-derivatized isomalto oligosaccharides with degree of polymerization 3–22 (TaKaRa-Bio, Shiga, Japan), and reported in glucose units (GU). PA-oligosaccharides derived from IVIG were identified by comparison with the GUs of reference PA-oligosaccharides in a web application, GALAXY (http://www.glycoanalysis.info/ ) [12] . The amount of PA-oligosaccharides was estimated using the peak area in the chromatogram.
4
Constructing DNA Constructs for Single-Molecule Assays
5
Rheumatopoietic Erythropoietin N-Glycan Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The purified rhEPO (50 μg) was denatured by heating at 95 °C for 5 min. N-glycans were released from rhEPO by incubation with PNGase F (Promega) at 37 °C for 3 hours and purified using GlycoClean R cartridges (Glyko; ProZyme, Hayward, CA). Purified N-glycans were labeled with 2-AB using 2-AB labeling kit (Glyko; ProZyme, Hayward, CA). The sample was subjected to an anion-exchange column (TSKgel DEAE-5PW, 7.5 mm × 75 mm; Tosoh, Tokyo, Japan) as described previously (Llop et al. 2007). These included solvent A (50% 0.5 M ammonium formate (pH 4.5)/acetonitrile (ACN)/distilled water (5:2:3, v/v/v)) and solvent B (20% (v/v) ACN in distilled water). 2AB-labeled N- glycans were separated in a linear gradient of buffer B from 0% (v/v) to 100% (v/v) over 45 min at a flow rate of 0.4 mL/min at 30 °C. 2-AB N-glycans of bovine fetuin (Glyko) were used as a standard.
6
Ion Exchange Chromatography Purification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A column (26 mm inner diameter and 30 cm length) was packed with 150 mL of the weak anionic exchange resin TSKgel DEAE-5PW (20 µm), factored by Tosoh Bioscience LCC. The sample (20 mg mL−1 in 0.05 sodium acetate pH 5.00) passed through the column three times to ensure its full complexation on the resin. Then, the column was eluted with 500 mL of sodium acetate solution (0.05 mM and pH 5.00) to remove unbound compounds.
Different concentrations of NaCl (0.1 M; 0.2 M; 0.3 M; 0.4 M; 0.5 M; 0.6 M; 0.7 M; 0.8 M; 0.9 M; and 1.0 M), were used to elute the samples. Excess salt in the eluates was removed by dialysis (MWCO < 6 kDa), and the eluates were lyophilized as described earlier [34 (link)]. The new fractions were named according with the concentrations of NaCl used in their preparation: CS0.1, CS0.2, CS0.3, CS0.4, CS0.5, CS0.6, CS0.7, CS0.8, CS0.9. CS1.0.Figure 6 outlines the methodology used for extract preparation.
Different concentrations of NaCl (0.1 M; 0.2 M; 0.3 M; 0.4 M; 0.5 M; 0.6 M; 0.7 M; 0.8 M; 0.9 M; and 1.0 M), were used to elute the samples. Excess salt in the eluates was removed by dialysis (MWCO < 6 kDa), and the eluates were lyophilized as described earlier [34 (link)]. The new fractions were named according with the concentrations of NaCl used in their preparation: CS0.1, CS0.2, CS0.3, CS0.4, CS0.5, CS0.6, CS0.7, CS0.8, CS0.9. CS1.0.
7
Constructing DNA Constructs for Single-Molecule Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A 2.7 kb DNA fragment that served as a “handle” in our single-molecule assay was amplified by PCR from the plasmid pRL702 as previously described33 (link), and was subcloned into the pDrive Cloning Vector (Qiagen). To obtain the three DNA constructs used in this study, three different plasmids were constructed, each containing the handle adjacent to one of the following promoter sequences: SNR20* short (−62/+636), SNR20* short ((−62/+96), and SNR20* long ((−/+96). For the assisting-load assay, the handle was located upstream of the SNR20* short (−62/+636) promoter sequence. For the hindering-load assay, the handle was situated downstream of the SNR20* short (−62/+96) or SNR20* long ((−122/+96) promoter sequence. Regions containing the promoter and the handle were amplified by PCR, using a 5′-digoxigenin labelled primer (IDT) that anneals to the end of the handle, such that PCR products carry a digoxigenin tag on the upstream end of DNA for the assisting-load assay, and on the downstream end of DNA for the hindering-load assay. The generated PCR products were loaded onto TSKgel DEAE-5PW (Tosoh), eluted by a gradient of 0.1-1 M NaCl in a buffer containing 20 mM Tris (pH 7.5) and 2 mM DTT, and concentrated up to 5-10 μM using Vivacon 500 5K MWCO (Vivaproducts), yielding ∼0.15-0.3 nmol from 4-8 mL PCR reaction.
8
Cloning Human α-Satellite DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Eight tandem repeats of the 166 base-pair human α-satellite DNA containing the CENP-B box sequence were ligated into the pGEM-T easy vector (Promega), which was amplified in E. coli DH5α cells. The 166 base-pair DNA sequence with the proximal CENP-B box is as follows: 5′-ATCTATTTGGACCGCATTGAGGCCTTCGTTGGAAACGGGA TTTCTTCATTTCATGCTAGACAGAAGAATTCTCAGTAACTTCTTTGTGCTGTGTGTATTCAACTCACAGAGTGGAACGTCCCTTTGCACAGAGCAGATTTGAAACACTCTTTTTGTAGTCGACGAT-3′. The 166 base-pair DNA sequence with the distal CENP-B box (-20) is as follows: 5′-ATCCTTCGTTGGAAACGGGA GGCTATCGTCTGCAGCGCCATTTCTTCATTTCATGCTAGACAGAAGAATTCTCAGTAACTTCTTTGTGCTGTGTGTATTCAACTCACAGAGTGGAACGTCCCTTTGCACAGAGCAGATTTGAAACACTCTTTTTGTAGTCGACGAT-’3. The CENP-B box sequences are underlined. The 166 base-pair DNA fragment was generated by EcoRV digestion, and was purified by TSK gel DEAE-5PW (TOSOH) anion exchange column chromatography.
9
Desialylation and Separation of N-glycans
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Desialylation of N-glycans was performed as described previously (Torii et al., 2014; Yoshimura et al., 2012 Yoshimura et al., , 2017)) . Purified pyridylaminated (PA)-N-glycans were treated with neuraminidase derived from Arthrobacter ureafaciens (Nacalai Tesque, Kyoto, Japan) at 37°C for 14 h to cleave sialic acids, followed by heating at 100°C for 5 min and filtering through a 0.20 μm spin filter (Ultrafree-MC LG, Merck Millipore). To separate neutral Nglycans from acidic ones, PA-N-glycans were passed through an anion exchange DEAE column (TSKgel DEAE-5PW, Tosoh, Tokyo, Japan) using HPLC or a Microgranular DE52-packed column (Whatman, GE Healthcare). Water adjusted to pH 9.0 with ammonia was used as a mobile solvent. Neutral N-glycans were collected in the non-adsorbed fraction.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!