Log In Sign up
The largest database of trusted experimental protocols

Non targeting control pool

Manufactured by Horizon Discovery
Visit Supplier
Sourced in United Kingdom

The Non-targeting control pool is a collection of synthetic, non-targeting small interfering RNA (siRNA) molecules designed to serve as a control for RNA interference (RNAi) experiments. This pool does not target any specific gene and is used to assess the effects of the RNAi process itself, without the influence of target-specific silencing.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine rnaimax, by Thermo Fisher Scientific (2 mentions) Smartpool sirna, by Horizon Discovery (1 mentions) Gene pulser xcell, by Bio-Rad (1 mentions) Lipofectamine rnaimax reagent, by Thermo Fisher Scientific (1 mentions) Interferin, by Polyplus Transfection (1 mentions) Mouse anti gapdh, by Thermo Fisher Scientific (1 mentions) Gapdh, by Thermo Fisher Scientific (1 mentions) Dharmafect 4 transfection reagent, by Horizon Discovery (1 mentions) Aphidicolin, by Merck Group (1 mentions) Rnaimax transfection reagent, by Thermo Fisher Scientific (1 mentions) Atr inhibitor az20, by Selleck Chemicals (1 mentions)

Close spelling variants of this product

SiGENOME Control Pool Non‐Targeting ON-TARGETplus Non-targeting Control Pool (D-001810-10) ON-TARGETplus Non-targeting Control Pool siRNA Non-targeting control pool (#D-001810-10-20) ON‐TARGET plus Control Non‐Targeting Pool ON-TARGETplus Control pool Non-targeting pool, ON-TARGET plus Non-targeting Control Pool cat. no. D-001810-10-20 SiGENOME Non-Targeting siRNA Control Pool SiGENOME Non-Targeting Control siRNA Pool #2 Scramble control oligonucleotide siRNA non-targeting pool

7 protocols using non targeting control pool

1

siRNA Knockdown of PAX2, PAX5, NFAT5

Check if the same lab product or an alternative is used in the 5 most similar protocols
4×106 Reh cells were electroporated with SMARTpool siRNA (i.e., 3 separate target siRNAs each) for PAX2, PAX5, NFAT5, or a non-targeting control pool (Dharmacon) using a BioRad GenePulser Xcell (Square wave, 210V, 15ms, 2x pulse, 0.1sec gap). Cells were suspended in 400μL Opti-MEM buffer containing 500nM siRNA that had been previously prepared and frozen at 20μM stock concentration in siRNA resuspension buffer (GE Healthcare). Cells were allowed to recover for 24 hours prior to harvest of protein lysates or treatment with hypertonic media (80mM K-Gluconate in RPMI with 10% FBS).
Hart M.R., Anderson D.J., Porter C.C., Neff T., Levin M, & Horwitz M.S. (2018). Activating PAX gene family paralogs to complement PAX5 leukemia driver mutations. PLoS Genetics, 14(9), e1007642.
+ Open protocol
+ Expand
2

NLRP3 and NLRC4 Knockdown in Primary Monocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Primary Mo preisolated from PBMC of healthy donors were nucleofected with siRNA specific for NLRP3 and NLRC4 and non-targeting control pool (Dharmacon) using a Nucleofector™ 4D and P3 Primary Cell kit (Lonza) using the manufacturer’s protocol. Nucleofected Mo were cultured overnight with medium containing 10% FBS without antibiotics and gene knockdown was confirmed by RT-qPCR.
Tsukalov I., Sánchez-Cerrillo I., Rajas O., Avalos E., Iturricastillo G., Esparcia L., Buzón M.J., Genescà M., Scagnetti C., Popova O., Martin-Cófreces N., Calvet-Mirabent M., Marcos-Jimenez A., Martínez-Fleta P., Delgado-Arévalo C., de los Santos I., Muñoz-Calleja C., Calzada M.J., González Álvaro I., Palacios-Calvo J., Alfranca A., Ancochea J., Sánchez-Madrid F, & Martin-Gayo E. (2024). NFκB and NLRP3/NLRC4 inflammasomes regulate differentiation, activation and functional properties of monocytes in response to distinct SARS-CoV-2 proteins. Nature Communications, 15, 2100.
+ Open protocol
+ Expand
3

Silencing DUSP1 in PC3 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human DUSP1 siRNA SMARTpool (#L-003484–02-005) and non-targeting control pool (#D-001810–10-05) was purchased from Dharmacon. PC3 cells (2.5 × 105 cells per well) were seeded on 6 well plates. PC3 cells were transfected with 25 and 50 nM siRNAs using Lipofectamine RNAiMAX reagent (Life Technologies) according to the manufacturer’s instructions. Transfections were performed on two consecutive days. RNA and protein were collected 72 h after the first transfection. Whole cell lysates were harvested in RIPA buffer (50 mM Tris pH 8, 150 mM NaCl, 1% NP-40, 0.1% SDS, 10 mM EDTA, 10 μg/mL aprotonin and leuptin, 1 mM PMSF, and 1 mM Na3VO4) and protein concentration was quantified using a Bradford Assay.
Briggs E.M., Mita P., Sun X., Ha S., Vasilyev N., Leopold Z.R., Nudler E., Boeke J.D, & Logan S.K. (2021). Unbiased proteomic mapping of the LINE-1 promoter using CRISPR Cas9. Mobile DNA, 12, 21.
+ Open protocol
+ Expand
4

Silencing TMEM41B in Human Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
ON-TARGET plus smart pool siRNAs against human TMEM41B and non-targeting control pool from Dharmacon were used at a concentration of 100 μM. The transfection reagent was INTERFERIN (409-10 from Polyplus). Silenced cells were used for IF analyses 96 h after transfections.
Boldt K., van Reeuwijk J., Lu Q., Koutroumpas K., Nguyen T.M., Texier Y., van Beersum S.E., Horn N., Willer J.R., Mans D.A., Dougherty G., Lamers I.J., Coene K.L., Arts H.H., Betts M.J., Beyer T., Bolat E., Gloeckner C.J., Haidari K., Hetterschijt L., Iaconis D., Jenkins D., Klose F., Knapp B., Latour B., Letteboer S.J., Marcelis C.L., Mitic D., Morleo M., Oud M.M., Riemersma M., Rix S., Terhal P.A., Toedt G., van Dam T.J., de Vrieze E., Wissinger Y., Wu K.M., Apic G., Beales P.L., Blacque O.E., Gibson T.J., Huynen M.A., Katsanis N., Kremer H., Omran H., van Wijk E., Wolfrum U., Kepes F., Davis E.E., Franco B., Giles R.H., Ueffing M., Russell R.B, & Roepman R. (2016). An organelle-specific protein landscape identifies novel diseases and molecular mechanisms. Nature Communications, 7, 11491.
+ Open protocol
+ Expand
5

ACT1 Knockdown and C. burnetii Infection

Check if the same lab product or an alternative is used in the 5 most similar protocols
MH-S cells (3 × 105 cells/well, in a 6-well plate) were reverse transfected with 50 nM small-interfering RNA (siRNA) SMARTpool specific for mouse ACT1 (Horizon Discovery) or non-targeting control pool (Horizon Discovery) using DharmaFECT 4 Transfection Reagent (Horizon Discovery). After 48 h, cells were infected with WT C. burnetii, for 2 h. Following washing with PBS, cells were harvested by trypsinization and subjected to a second round of siRNA transfection into a 24-well plate (3.5 × 104 cells/well). At 2 and 5 days post-infection (dpi), cells were harvested, lysed with 1x RIPA Buffer containing phosphatase and protease inhibitors, and analyzed by immunoblotting to confirm ACT1 knockdown. The membrane was probed separately using mouse anti-ACT1 (1:1000; Santa Cruz) and mouse anti-GAPDH (1:1000; Thermo Fisher Scientific) antibodies in 5% milk in TBS-T, where GAPDH was used as loading control. After washing, the blot was incubated with HRP-conjugated anti-mouse secondary antibody in 5% milk in TBS-T, and developed using enhanced chemiluminescence (ECL) reagent. Densitometry data was done in ImageJ (Fiji) software, using the Easy Band Quantification plugin.
Clemente T.M., Augusto L., Angara R.K, & Gilk S.D. (2023). Coxiella burnetii actively blocks IL-17-induced oxidative stress in macrophages. bioRxiv.
+ Open protocol
+ Expand
6

Inducing Replication Fork Collapse

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Expression of shWRN was induced by adding 1 μg ml−1 doxycycline to cell culture medium for indicated time. The following siRNAs were used for experiments: siGenome Human siRNA Smartpool targeting WRN, MUS81, and SLX4, as well as non-targeting control pool (Horizon Discovery). WRN 5′ UTR (AAACCCGAGAAGAUCCAGUCCAACA) was described previously3 (link) and ordered from ThermoFisher. Cells were transfected using RNAiMax Transfection Reagent (ThermoFisher) according to manufacturer’s instructions. To induce exogenous replication fork collapse, cells were treated with aphidicolin (0.2 μg ml−1, Sigma Aldrich) for 24 h, and ATR inhibitor AZ20 (10μM, SelleckChem) was added for the final 8 h.
van Wietmarschen N., Sridharan S., Nathan W.J., Tubbs A., Chan E.M., Callen E., Wu W., Belinky F., Tripathi V., Wong N., Foster K., Noorbakhsh J., Garimella K., Cruz-Migoni A., Sommers J.A., Huang Y., Borah A.A., Smith J.T., Kalfon J., Kesten N., Fugger K., Walker R.L., Dolzhenko E., Eberle M.A., Hayward B.E., Usdin K., Freudenreich C.H., Brosh RM J.r., West S.C., McHugh P.J., Meltzer P.S., Bass A.J, & Nussenzweig A. (2020). Repeat expansions confer WRN dependence in microsatellite-unstable cancers. Nature, 586(7828), 292-298.
+ Open protocol
+ Expand
7

RNAi-Mediated Knockdown of EGFR and BRAF

Check if the same lab product or an alternative is used in the 5 most similar protocols
Small interfering (si) RNAs were purchased from Horizon Discovery (Waterbeach, United Kingdom) and included the following: ON-TARGETplus Non-targeting Control Pool (D-001810-10-05), ON-TARGETplus Human EGFR siRNA SMARTPool (L-003114-00-0005), and ON-TARGETplus Human BRAF siRNA SMARTPool (L-003460-00-0005). They were transfected at a final concentration of 30 nM using lipofectamine RNAiMax (Thermo Fisher Scientific, Waltham, MA) according to the manufacturer's protocol. HCC827, H2291, and X12CL cells were cultured in R10 medium in 96-well plates at 3000 cells per well in 100 mL for cell growth experiments and seeded in 6-well plates at 300,000 cells per well in 3 mL for biochemical assays. After overnight seeding, cells were transfected with siRNAs for 72 hours, at which point cell growth was quantified in 96-well plates and cells in 6-well plates were lysed for protein extraction.
Huo K.G., Notsuda H., Fang Z., Liu N.F., Gebregiworgis T., Li Q., Pham N.A., Li M., Liu N., Shepherd F.A., Marshall C.B., Ikura M., Moghal N, & Tsao M.S. (2022). Lung Cancer Driven by BRAFG469V Mutation Is Targetable by EGFR Kinase Inhibitors. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer, 17(2).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!