For RNA interference experiments, control (Dharmacon siGLO RISC-free control siRNA), Gαs, or PKA Cα siRNAs (Dharmacon) were transfected into cells using a calcium phosphate method. Briefly, 2.5M CaCl2 was added to siRNA (5μM) diluted in 2X HBS. The transfection mixture was mixed vigorously, incubated for 20 min at room temperature and added dropwise to plate containing 50% confluent cells. Cells were plated on CL 96 hrs post-transfection and experiments were performed. The following siRNA sequences were used in this study: Gαs: 5′-CCACCAAAGUGCAGGACAUUU-3′; PKA Cα: 5′-GAGUAAAGGCUACAACAAAUU -3′. For GFP-PH experiments, cells were seeded at 50% confluence and transfected with 2.5 μg of the GFP-PH construct using Effectene reagents (QIAGEN) according to the manufacturer’s protocol. Experiments were performed 48 hr after transfection.
Siglo risc free control sirna
Manufactured by Horizon Discovery
Sourced in United States
SiGLO RISC-free control siRNA is a laboratory product designed to serve as a control for RNA interference (RNAi) experiments. It is a synthetic double-stranded RNA molecule that does not target any known gene, allowing it to be used as a reference to assess the effects of specific small interfering RNA (siRNA) molecules in cellular studies.
Automatically generated - may contain errors
Lab products found in correlation
Pka cα sirnas, by Horizon Discovery (2 mentions)
Effectene reagent, by Qiagen (2 mentions)
Dharmafect 3 transfection reagent, by Horizon Discovery (1 mentions)
Scramble sirna, by Horizon Discovery (1 mentions)
D 001206 13 05, by Horizon Discovery (1 mentions)
Smartpool, by Horizon Discovery (1 mentions)
Hiperfect, by Qiagen (1 mentions)
Plko tet on system, by Merck Group (1 mentions)
Lipofectamine rnaimax, by Thermo Fisher Scientific (1 mentions)
7 protocols using siglo risc free control sirna
1
Silencing Gαs and PKA Cα via siRNA Transfection
2
Efficient siRNA Transfection of C2C12 Myotubes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C2C12 myotubes were transfected with scramble siRNA (GE Dharmacon, Lafayette, CO, USA) or gp130 siRNA (Santa Cruz Biotech, Santa Cruz, CA, USA) 3 days post-differentiation using DharmaFECT 3 transfection reagent (GE Dharmacon, Lafayette, CO, USA), according to the manufacturer's instructions and as previously described [43 (link)]. Briefly, siRNA and transfection reagent were separately diluted in serum-free and antibiotics-free DMEM and incubated at room temperature for 5 min [43 (link)]. The diluted transfection reagent was then added to the siRNA mixture and allowed to complex with siRNA for 20 min. siRNA-transfection reagent complexes were then added to the antibiotics-free differentiation medium, and myotubes were incubated for 24 hours in a transfection-containing medium (100 nM siRNA concentration). Transfection efficiency was validated by cotransfecting 20 nM (final concentration) of siGLO RISC-Free Control siRNA (GE Dharmacon, Lafayette, CO, USA). Fluorescence was visualized by a Cy3 filter to determine the transfection efficiency. Validated transfected myotubes were collected for protein analysis.
3
Silencing Gαs and PKA Cα via siRNA Transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For RNA interference experiments, control (Dharmacon siGLO RISC-free control siRNA), Gαs, or PKA Cα siRNAs (Dharmacon) were transfected into cells using a calcium phosphate method. Briefly, 2.5M CaCl2 was added to siRNA (5μM) diluted in 2X HBS. The transfection mixture was mixed vigorously, incubated for 20 min at room temperature and added dropwise to plate containing 50% confluent cells. Cells were plated on CL 96 hrs post-transfection and experiments were performed. The following siRNA sequences were used in this study: Gαs: 5′-CCACCAAAGUGCAGGACAUUU-3′; PKA Cα: 5′-GAGUAAAGGCUACAACAAAUU -3′. For GFP-PH experiments, cells were seeded at 50% confluence and transfected with 2.5 μg of the GFP-PH construct using Effectene reagents (QIAGEN) according to the manufacturer’s protocol. Experiments were performed 48 hr after transfection.
4
Knockdown of SERPINA4 in HUVECs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate SERPINA4 knockdown cells, HUVECs were transfected with small interfering RNA (siRNA) targeting the human kallistatin gene SERPNA4. The ON-TARGETplus human SERPINA4 (5267) siRNA-SMARTpool (25 nM, target sequence: 5’-GGUGAGAGUUGCAGUAACA-3’, 5’-CAAUCC-AGCUUAUCAACGA-3’, 5’-CCACCAGCUUCGCGAUCAA-3’, 5’-GCAAAAUG-AGGGAGAUUGA-3’; Cat. L016371000050, Dharmacon) and siGLO RISC-Free Control siRNA (Cat. D0016000105, Dharmacon) as control were used for transfection. HUVECs were treated with these siRNAs using DharmaFect1 transfection reagent (Cat. T2001-03, Dharmacon) aaccording to the manufacturer's instructions for 6 hours and then cultured for 18 hours in complete media before further experiments.
5
Intravitreal siRNA Delivery in Mouse Retina
6
CD11b Knockdown in Immature DCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Knockdown of CD11b protein with small interfering RNA (siRNA) in immature DCs was done by transfecting immature DCs at day 2 or 3 of culture with siRNA using the transfection reagent DF4 (Dharmacon) or HiPerFect (Qiagen), respectively. The transfection reagents were removed, and the cells were used for experiments 2 days after transfection. The siRNA (Smart pool; Dharmacon) was specific for CD11b (Human ITGAM M-008008-01). A nontargeting siRNA control pool (D-001206-13-05; Dharmacon) served as a control. The transfection efficiency was determined by flow cytometry of cells transfected with siGlo RISC-Free Control siRNA (D-001600-01; Dharmacon). Silencing of CD11b expression was verified by real-time PCR and flow cytometry.
7
Inducible SETDB1 Knockdown Using shRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two independent siRNAs were used to knock down SETDB1. The respective sequences are si-Q3: 5′- CAGCATGCGAATTCTGGGCAA -3′, si-Q4: 5′- TCGGGTGGTCGCCAAATACAA -3′, Ctrl-siRNA: siGLO RISC-Free Control siRNA (Dharmacon). siRNAs were transfected using Lipofectamine RNAiMAX (Invitrogen) and assayed for 3–5 days after transfection. The shRNA against p53 was ordered from Sigma (Clone ID: NM_000546.4-887s21c1). The sequence is: 5′- CCGGCACCATCCACTACAACTACATCTCGAGATGTAGTTGTAGTGGATGGTGTTTTTG -3′.
For inducible shRNA, the shRNA sequence was cloned into the single lentiviral-based Tet-on-inducible vector pLKO-Tet-on system (Sigma) as previously reported40 (link). The sequences of shRNAs that target SETDB1 are: sh1-5′: 5′- CCGGGTTCGGCTACAGCTATTCACTCGAGTGAATAGCTGTAGCCGAACTTTTT -3′; sh1-3′: 5′- AATTAAAAAGTTCGGCTACAGCTATTCACTCGAGTGAATAGCTGTAGCCGAAC -3′; sh2-5′: 5′- CCGGGATGTGAGTGGATCTATCGCTCGAGCGATAGATCCACTCACATCTTTTT -3′; sh2-3′: 5′- AATTAAAAAGATGTGAGTGGATCTATCGCTCGAGCGATAGATCCACTCACATC -3′. Each pair of shRNAs was annealed and inserted into the pLKO-Tet-on vector and co-transfected into 293T with pCG10 and pCG41. Cell supernatants were collected 48 h after transfection and passed through a 0.22-μm filter. Cells were infected with the virus supernatant and were cultured in medium containing 2 μg ml−1 puromycin for stable cell line selection.
For inducible shRNA, the shRNA sequence was cloned into the single lentiviral-based Tet-on-inducible vector pLKO-Tet-on system (Sigma) as previously reported40 (link). The sequences of shRNAs that target SETDB1 are: sh1-5′: 5′- CCGGGTTCGGCTACAGCTATTCACTCGAGTGAATAGCTGTAGCCGAACTTTTT -3′; sh1-3′: 5′- AATTAAAAAGTTCGGCTACAGCTATTCACTCGAGTGAATAGCTGTAGCCGAAC -3′; sh2-5′: 5′- CCGGGATGTGAGTGGATCTATCGCTCGAGCGATAGATCCACTCACATCTTTTT -3′; sh2-3′: 5′- AATTAAAAAGATGTGAGTGGATCTATCGCTCGAGCGATAGATCCACTCACATC -3′. Each pair of shRNAs was annealed and inserted into the pLKO-Tet-on vector and co-transfected into 293T with pCG10 and pCG41. Cell supernatants were collected 48 h after transfection and passed through a 0.22-μm filter. Cells were infected with the virus supernatant and were cultured in medium containing 2 μg ml−1 puromycin for stable cell line selection.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!