Myiqtm2

Total RNA was extracted from the mouse livers and hepatocytes using Trizol reagent (Invitrogen, USA). The cDNAs were synthesized using a reverse transcription kit (ReverTra Ace qPCR RT Kit, TOYOB, Japan), and real-time PCR was performed using SYBR green master mix (SYBR GREEN PCR, TOYOB, Japan) on a MyiQTM2 (BIORAD, USA). GAPDH was used to normalize the real-time PCR data. The following primer sequences were used: Wnt1-s, 5′CGAGGCTGCCGAGAAACA 3′ and 5′ GCCAAAGAGGCGACCAAAA 3′; Wnt2, 5′ GAAGTAGTCGGGAATCGG 3′ and 5′ CATCCTTGCCTTTCCTCT3′; wnt3a, 5′ ACCACCGTCAGCAACAGC 3′ and 5′ GCGTGTCACTGCGAAAGC 3′; wnt5a, 5′ CAGGTCAACAGCCGCTTCAAC 3′ and 5′ACAATCTCCGTGCACTTCTTGC 3′; DKK1, 5′AGCCAGTGCCACCTTGA3′ and 5′ TTGTTCCCGCCCTCATA 3′; Fz1, 5′ ATGACGGCACCAAGACAGA 3′ and 5′ GGCAAGGGATGGCATAACTC 3′; CTGF, 5′ TGTGAAGACATACAGGGCTAAG 3′ and 5′ ACAGTTGTAATGGCAGGCAC 3′; Sox9, 5′ GCGAACGCACATCAAGACG 3′ and 5′ GTAAGTGAAGGTGGAGTAGAGCC 3′; GAPDH, 5′ GTGTTTCCTCGTCCCGTAG 3′ and 5′ATGGCAACAATCTCCACTTT 3′; Wnt3, 5′TGCCAGCATCAGTTCCG3′ and 5′TGACTGCGAAGGCGACA3′; TGF-β, 5′ CCCACTGATACGCCTGAG 3′ and 5′ GGGCTGATCCCGTTGAT 3′; Fz5, 5′ACACGCAGGACGAAGCAG3′ and 5′TGTGGTAGTCAGGCAAACAGAT3′; Axin2, 5′CAACGACAGCGAGTTATCC3′ and 5′GTTCCACAGGCGTCATCT3′; Myc, 5′GACTGTATGTGGAGCGGTTTC3′ and 5′CGTTGAGCGGGTAGGGA3′; Twist1, 5′CAGCGGGTCATGGCTAACG3′ and 5′CAGGACCTGGTACAGGAAGTCGA3′.

Gene expressions in the ovarian samples (n = 4) were detected by quantitative real-time PCR (qPCR), including 16 genes related to lipid metabolism, 8 genes involved in yolk protein and amino acids metabolism. Total RNA was extracted, quantified spectrophotometrically, and the integrity was assessed by agarose gel electrophoresis. The cDNA was synthesized using a PrimeScript^TM RT reagent Kit with gDNA Eraser (TakaRa, Dalian, China). The suitability of internal standard genes was assessed by agarose gel electrophoresis of relative quantity PCR product. The qRT-PCR was carried out by a quantitative thermal cycler (MyiQTM 2, BIO-RAD, CA, USA) in 20 μl reaction volume using SYBR® Green Realtime PCR Master Mix (TOYOBO, Osaka, Japan) according to the manufacturer’s instruction. Primers in Table 1 were designed through Primer Premier 5.0 software according to gene sequences obtained from NCBI. The qRT-PCR parameters were composed of initial denaturation at 95 ºC for 30 s, followed by 40 cycles at 95 ºC for 5 s, 57 ºC for 10 s and 72 ºC for 15 s. The expression level of each tested gene was normalized to β-actin and 18s-RNA, and calculated by the 2^-∆∆CT method [21 (link)].

Genomic DNA was isolated from cells using the QIAamp DNA mini kit (QiagenInc) according to the manufacturer's instructions. DNA was diluted with 50 μL nuclease‐free water (Life Technologies) and DNA concentration was calculated. Quantitative PCR assay was performed using a real‐time PCR assay with Bio‐Rad MyIQTM 2. Concentrations of EBV DNA were measured using primers flanking the BamHI‐W region of the EBV genome. The sequence of the forward and reverse primers of the BamHI W region was 5′‐CCCAACACTCCACCACACC‐3′ and 5′‐TCTTAGGAGCTGTCCGAGGG‐3′, respectively. A dual‐labeled TaqMan probe (5′‐FAM‐CACACACTACACACACCCACCCGTCTC‐BHQ‐1‐3′) served as a probe. The Namalwa (ATCC® CRL‐1432TM) DNA was used to create a six‐point 10‐fold serial dilution series, ranging from 10⁶ copies/μL to 10¹ copies/μL, that was used to obtain the standard curve.