GPR137 mRNA levels were measured by qRT-PCR analysis using the 2× SYBR Green Master Mix Kit with the DNA Engine Opticon™ System (MJ Research, Waltham, MA, USA). The PCR reaction mixture added to each vial contained 10 µL of 2× SYBR Green Master Mix, 0.8 µL of forward and reverse primers (2.5 µM), and 5 µL of cDNA (2 ng). The PCR experiment was carried out using the following protocol in a BioRad Connect RT-PCR platform: initial denaturation at 95 °C for 1 min, 40 cycles of denaturation at 95 °C for 5 s, and annealing extension at 60 °C for 20 s. Actin was used as the housekeeping mRNA reference. The primers (5′ to 3′) used for GPR137 expression analysis were: GPR137: forward (ACCTGGGGAACAAAGGCTAC) and reverse (TAGGACCGAGAGGCAAAGAC); actin: forward (GTGGACATCCGCAAAGAC) and reverse (AAAGGGTGTAACGCAACTA). Relative gene expression levels were quantified using the 2-ΔΔCT method.
Dna engine opticon system
Manufactured by Bio-Rad
Sourced in United States
The DNA Engine Opticon System is a real-time PCR detection system designed for gene expression analysis, genotyping, and other quantitative PCR applications. It features a powerful optical system and thermal cycler technology to provide accurate and reliable data for a wide range of sample types and reaction volumes.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (12 mentions)
Dnase 1, by Thermo Fisher Scientific (5 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (5 mentions)
Rneasy mini kit, by Qiagen (4 mentions)
Maxima sybr green master mix, by Thermo Fisher Scientific (4 mentions)
Sybr green real time pcr master mix, by Bio-Rad (3 mentions)
Primescript rt reagent kit, by Takara Bio (2 mentions)
Iq sybr green supermix, by Bio-Rad (2 mentions)
Superscript 2 reverse transcriptase kit, by Thermo Fisher Scientific (2 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Purelink rna mini kit, by Thermo Fisher Scientific (2 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Quick rna miniprep kit columns, by Zymo Research (2 mentions)
Quanttect sybr green rt pcr kit, by Qiagen (2 mentions)
Hp8452a apparatus, by Hewlett-Packard (2 mentions)
Rt pcr kit, by Transgene (1 mentions)
Rna purification kit, by Qiagen (1 mentions)
Sybr green, by Bio-Rad (1 mentions)
Sybr premix ex taq, by Takara Bio (1 mentions)
Iscript kit, by Bio-Rad (1 mentions)
37 protocols using dna engine opticon system
1
Quantifying GPR137 mRNA Expression by qRT-PCR
2
Quantifying mRNA Levels in Blood Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time PCR was performed to determine mRNA levels of SPL and SGPP1/2 from peripheral blood of the patients and healthy volunteers. Total RNA was extracted using the TRIzol reagent (Invitrogen, USA) and reverse transcription was performed using an RT-PCR kit (TransGen Biotech, China). Real-time experiments were conducted on a DNA Engine Opticon System (MJ research Inc, USA) using SYBR Green PCR Master Mix kit in triplicate specific primers. The sequences of primers to determine the expression of the target gene were as follows: SPL [5’-CTTGATGCACTTCGGTGAGA-3’ (forward); 5’-TCCACCCCTTAGCAGTCATC-3’ (reverse)], SGPP1 [5’-ACCGCCATCCCCATTTCT-3’ (forward); 5’-AGGAATCCAGCAATAATATCCAG-3’ (reverse)], SGPP2 [5’-gTATTATACTCATGGTTCAAGGTG-3’ (forward); 5’-GTGTAGGTAACAAACTTGTAAGG-3’ (reverse)] and Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) [5’-CGGAGTCAACGGATTTGGTCGTAT-3’ (forward); 5’-AGCCTTCTCCATGGTGGTGAAGAC-3’ (reverse)]. The PCRs consisted of 5 min at 95°C followed by 40 cycles of denaturation for 30 sec at 95°C, annealing for 30 sec at 56°C and a primer extension for 30 sec at 72°C. The comparative CT method was used to quantify the expression of SPL, SGPP1 and SGPP2 using GAPDH as the normalized control.
3
Zebrafish Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total DNA-free RNA were extracted at 30 hpf with RNA purification kit (Qiagen, Germany). Gene-specific primers of actin, yap1 and prox1a were designed (1st BASE), sequence were as follows: actin forward, 5′-ATGATGCCCCTGGTGCTGTTTTC-3′; actin reverse, 5′-TCTCTGTTGGCTTTGGGATTCA- 3′; yap1 forward, 5′-GATAAAGCGGCCGGACACAGA-3′, yap1 reverse 5′-AGGTGGTTTTGTTCTTGTGAT-3′; prox1a forward, 5′-AGAACGCGGCAACTCAAACTACA -3′; prox1a reverse, 5′-CCATCATGCTCTGCTCCCGAATAA-3′. Observation of band-shift in yap1 RNA transcript of morphants was performed with One-Step RT-PCR (Qiagen, Germany) and gel electrophoresis. One-step RT-PCR with SYBR Green was performed according to manufacturer's manual (BioRad, USA) and ran in DNA Engine Opticon System (MJ Research, USA). Threshold cycle of each target gene in control and morphant was determined by using a housekeeping gene, actin, as a reference gene loading control for normalization. Fold change was calculated with delta-C(t) method and Microsoft Excel Student's two tailed t-test with respect to mismatch control. Primers that detect band-shift in yap1 RNA transcript from One-step RT-PCR gel electrophoresis analysis was: 277F, 5′-GATAAAGCGGCCGGACACAGA-3′: 1027R, 5′-AGGTGGTTTTGTTCTTGTGAT-3′.
4
RNA Extraction and Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was purified using TRIzol Reagent (Invitrogen Life Technologies, Carlsbad, CA) following the manufacturer’s instruction. The quality of RNA was examined by A260 absorption. And 500 ng of total RNA was reversely transcribed into first-strand cDNA using PrimeScript RT reagent kit (Takara, Tokyo, Japan). Real-time PCR in triplicate was performed on a DNA Engine Opticon system (MJ Research, Reno, NV) using SYBR Premix Ex Taq (TaKaRa, Tokyo, Japan). And the reaction was evaluated with the Opticon Monitor software (Version 1.02). The primer sequences for interested mRNAs were synthesized by Sangon Biotech (Sangon Biotech, Shanghai, China; Additional file 1 : Table S1). The threshold cycle (Ct) values were analyzed using the comparative Ct (ΔΔCt) method as previously reported [17 (link)]. The level of target mRNA was obtained by normalizing to the endogenous reference and relative to a control.
5
Analyzing Gene Expression in Zebrafish
6
Cofilin mRNA Quantification in PC-3 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ALN-treated PC-3 cells were lysed and total RNA was purified by using an RNeasy Mini Kit (Qiagen). Complementary DNA was synthesized by using 1 μg of total RNA as starting material. Cofilin mRNA quantification was performed by Quantitect SYBR green real time PCR kit (Qiagen) with a DNA Engine Opticon system (MJ Research, Inc., USA). Amplification conditions were as recommended in the Quantitect SYBR green handbook for two-step qRT-PCR (Qiagen, USA). The primers used were as follows: human cofilin: 5’-GATAAGGA CTGCCGCTATGC-3’, 5’-GCTTGATCCCTGTC AGCTTC-3’, human β-actin: 5’-CGTGGGG CGCCCCAGGCACCA-3, 5’-TTGGCCTTGGGGT TCA GGGGG-3’. Annealing temperature of 60 °C and 35 amplification cycles were used. The amount of cofilin mRNA was normalized to β-actin expression and each treatment was carried out in triplicate. The results were analyzed using the 2-ΔΔCT method [59 (link)].
7
Quantification of Gene Expression in Embryos
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from embryos at desired developmental stages and purified using the Qiagen RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. Complementary DNA (cDNA) was synthesized with Superscript III reverse transcriptase and oligo-dT primer (Invitrogen) according to the manufacturer’s instructions. Quantitative RT-PCR was performed using the DNA Engine Opticon System (MJ Research Inc.) with iQ SYBR Green Supermix (BioRad) or using the LightCycle 96 instrument (Roche Inc.) with SYBR Green I Master (Roche). qPCR primers are listed in Additional file 1 : Table S1. Relative gene expression levels were analyzed by the ΔΔ Ct method, with elongation factor 1α (EF1α) as a reference gene All reactions were performed as biological triplicates.
8
Quantitative Real-Time PCR Analysis of Plant Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from plant samples using the TRIZOL reagent (Invitrogen). After being treated with DNase I (Invitrogen) to remove DNA contamination, cDNA was synthesized using SuperScript II reverse transcriptase kit (Invitrogen). The quantitative real-time PCR analysis was performed on the DNA Engine Opticon System (MJ Research) using the SYBR Green Realtime PCR Master Mix (Bio-Rad). All experiments were performed using three biological replicates, and actin served as an internal standard. The relative expression of each gene was calculated using ΔΔCT method (2-ΔΔCT)62 (link). Each experiment was repeated with three different batches of samples and RT-PCR reactions were performed with three technical replicates for each sample. The primers used in quantitative real-time PCR are listed in Supplementary Table 1 .
9
Quantitative Analysis of Corneal ECM Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Initial screening of cDNA for different genes of interest was performed using real-time PCR (RT–PCR). Primers were designed using Primer3 combined with BLAST from NCBI (Bethesda, MD) and primers (Table 1 ) were synthesized by Integrated DNA Technologies (Coralville, IO).
The quantitative measurement of nidogen-1, nidogen-2, perlecan, and LAMA3 mRNA levels from different corneal layers was performed with real-time PCR using a DNA Engine Opticon system (MJ Research, MA) with the SYBR Green PCR Master Mix (BioRad) in a one-step reaction according to the manufacturer’s instructions. The thermal cycle was programmed for 30 s at 98 °C for initial denaturation, followed by 35 cycles of 10 s at 98 °C for denaturation, 10 s at 59°C for annealing, 10 s at 72 °C for extension, and 1 min at 72 °C for the final extension. The melting curves and gel electrophoresis of the end products were obtained to confirm the specificities of the PCR reactions. The relative quantification of target genes was determined using the ΔΔCt quantitative RT–PCR method [30 (link)].
The quantitative measurement of nidogen-1, nidogen-2, perlecan, and LAMA3 mRNA levels from different corneal layers was performed with real-time PCR using a DNA Engine Opticon system (MJ Research, MA) with the SYBR Green PCR Master Mix (BioRad) in a one-step reaction according to the manufacturer’s instructions. The thermal cycle was programmed for 30 s at 98 °C for initial denaturation, followed by 35 cycles of 10 s at 98 °C for denaturation, 10 s at 59°C for annealing, 10 s at 72 °C for extension, and 1 min at 72 °C for the final extension. The melting curves and gel electrophoresis of the end products were obtained to confirm the specificities of the PCR reactions. The relative quantification of target genes was determined using the ΔΔCt quantitative RT–PCR method [30 (link)].
10
Gene Expression Analysis of Mg-Starvation Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from plant materials using the TRIzol reagent (Invitrogen). After being digested by DNase I (Invitrogen) to decontaminate DNA, cDNA was generated from RNA samples at 42°C using SuperScript II reverse transcriptase (Invitrogen). The resultant cDNA samples were used for PCR amplification with the gene-specific primers. Quantitative real-time PCR was performed on the DNA Engine Opticon System (MJ Research) using the SYBR Green Realtime PCR Master Mix to monitor double-stranded DNA products. Data were calculated based on the comparative threshold cycle method. The relative expression of each Mg-starvation marker gene was double-normalized using the housekeeping gene ACTIN2 and using the control expression values measured in the wild type when external Mg2+ is 1.5 mM.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!