Trizol based protocol

Cells were washed with PBS and then lysed in RIPA lysis buffer; cellular protein lysates were isolated using the protein extraction kit (QIAGEN, Portland, OR, USA) and quantified using the Bradford protein assay kit (Bio-Rad, Taiwan). Approximately 20 μg of the sample from different experiments were loaded and subjected to SDS-PAGE by using the Mini-PROTEAN III system (Bio-Rad, Taipei, Taiwan). Separated proteins were transferred onto a polyvinylidene fluoride (PVDF) membrane by using the Trans-Blot Turbo Transfer System (Bio-Rad), followed by blocking with Tris-buffered saline plus skimmed milk. These PVDF membranes were then probed with respective primary antibodies, followed by the secondary antibody. The commercial antibodies are shown in Supplementary Table S2. The enhanced chemiluminescence detection kit was used to detect the proteins of interest. Images were captured and analyzed using the UVP BioDoc-It system (Upland, CA, USA). qRT-PCR was performed by using isolating total RNA using TRIzol-based protocol (Life Technologies, San Jose, CA, USA) provided by the manufacturer. In brief, one µg of total RNA was reverse transcribed using QIAGEN OneStep RT-PCR kit (QIAGEN, Taipei, Taiwan), and PCR was performed using a Rotor-Gene SYBR Green PCR kit (QIAGEN, Tiapei, Taiwan). The primer sequences are shown in Supplementary Table S3.

Total RNA extracted from ventricular cardiomyocyte AC16 cells treated with Lp(a) or Lp(a) + garcinol using TRIzol-based protocol (Life Technologies), following the manufacturer’s recommendation. A total of 2 ug RNA was reverse transcribed by QIAGEN OneStep real-time polymerase chain reaction (RT-PCR) Kit (QIAGEN, Taiwan), and the PCR was performed under the following condition: reverse transcription at 42 °C for 60 min, amplification for 30 cycles at 94 °C for 30 s, 58 °C for 50 s, and 72 °C for 50 s. The primers sequence for target genes and the microRNA was shown in Supplementary Table S1.

The total RNA was isolated and purified using TRIzol-based protocol (Life Technologies) according to the vendor’s instructions. Ten nanograms of total RNA were reverse transcribed using QIAGEN OneStep RT-PCR Kit (QIAGEN, Taiwan), and the PCR reaction was carried out using a Rotor-Gene SYBR Green PCR Kit (400, QIAGEN, Taiwan). The primer sequences for q-PCR experiments are as listed below:

Gene	Forward	Reverse
AGR3	CATCACCTGGAGGATTGTCAATAC	TGAACTTATTCTGAGCCATTTCTTGT
CD23	GGGAGAATCCAAGCAGGAC	GGAAGCTCCTCGATCTCTGA
CD64	TGGGAAAGCATCGCTACAC	GCACTGGAGCTGGAAATAGC
CCR7	TCATTGCCGTGGTGGTAGTCTTCA	ATGTTGAGCTGCTTGCTGGTTTCG

(additional primer sequences may be found in Additional file 1: Figure S2).

GB cells were washed with PBS and then lysed in RIPA lysis buffer. Cellular protein lysates were isolated using Protein Extraction Kit (Qiagen, Germantown, MD, USA) and quantified using Bradford Protein Assay Kit (Qiagen). In total, 20 μg of samples from different experiments were loaded and subjected to SDS-PAGE using the Mini-Protean III system (Bio-Rad, Taipei City, Taiwan). Separated proteins were transferred onto polyvinylidene fluoride (PVDF) membranes using Trans-Blot Turbo Transfer System (Bio-Rad) followed by blocking with Tris-buffered saline plus skim milk. Then, these PVDF membranes were probed with respective primary antibodies followed by a secondary antibody. The primary antibodies for CD133, KLF4, and SOX2 are shown in Supplementary Table S1. ECL detection kit was used for detecting proteins of interest. Images were captured and analyzed using an UVP BioDoc-It system (Analytik Jena, Thuringia, Germany). RT-qPCR was performed using isolated total RNA according to the TRIzol-based protocol (Life Technologies, Carlsbad, CA, USA) provided by the manufacturer. One microgram of total RNA was reverse transcribed using a Qiagen OneStep RT-PCR Kit (Qiagen), and the PCR reaction was performed using a Rotor-Gene SYBR Green PCR Kit (400, Qiagen).

TRIzol-based protocol (Life Technologies) was used to isolate total RNA and purify according to manufacturer instructions. One microgram of total RNA was reverse transcribed using QIAGEN OneStep RT-PCR Kit (QIAGEN, Taiwan), and the PCR reaction was carried out using a Roto-Gene SYBR Green PCR Kit (400, QIAGEN, Taiwan). The primer sequence for genes, SOX2, forward: 5′-AAATGGGAGGGGTGCAAAAGAGGAG-3′ and reverse: 5′-CAGCTGTCATTTGCTGTGGGTGATG-3′. Nanog, forward: 5′-AATACCTCAGCCTCCAGCAGATG-3′ and reverse: 5′-TGCGTCACACCATTGCTATTCTTC-3′. β-catenin, forward: 5′-ACTGGCAGCAACAGTCTTACC-3′ and reverse: 5′-TTTGAAGGCAGTCTGTCGTAAT-3′. The primer sequences internal control RPLP0 were: forward: 5′-TGGTCATCCAGCAGGTGTTCGA-3′ and reverse: 5′-ACAGACACTGGCAACATTGCGG-3′. List of microRNA primer sequences was enumerated in Supplementary Table S1.

Total RNA was isolated and purified using TRIzol-based protocol (Life Technologies) according to the protocol provided by the manufacturer. The RNA concentration and purity were determined with a NanoDrop 1000 spectrophotometer (Nyxor Biotech, Paris, France). One microgram of total RNA was reverse-transcribed using a Qiagen OneStep RT-PCR Kit (Qiagen), and the PCR was performed using a Rotor-Gene SYBR Green PCR Kit (400, Qiagen, Taipei, Taiwan). Details of qPCR primers used for this study are listed in Supplementary Table S1.

Total mRNA was extracted with the standard Trizol-based protocol (Invitrogen, USA), and PrimeScript RT Reagent Kit (Invitrogen, USA) performed a reverse transcription reaction. The qPCR was conducted by SYBR Premix Ex Taq (TaKaRa, China). Finally, a semi-quantitative analysis was performed. This technique was adopted in our study to examine the relative mRNA expression of CCL2, CCL15, and CCL28.