Oligo dt 15 primer

Total RNA was extracted with Trizol Kit (Invitrogen, Carlsbad, CA, USA) from fifth-instar larvae of M. separata and the first-strand cDNA was synthesized using an oligo(dT)15 primer (Tiangen Biotech, Beijing, China) following the manufacturer’s instructions. The integrity of RNA was checked on an 1% agarose gel and Nanophotometer NP80 (IMPLEN, München, Germany) determined the concentration of RNA.
The complete open reading frames (ORFs) of MsTβh were amplified from larval cDNA. Primer (Tβh-F: 5′ATGGCTCTAAAGTGTATAGT 3′; Tβh-R: 5′ TTTTTCAATAATCGTGTCGG 3′) were designed based on the transcriptome data of M. separata with Primer Premier 6.0. The larval transcriptome dataset of M. separata has been released in the SRA database (SRP153130).
PCR amplification was carried out under the condition of one cycle at 95 °C for 3 min, 35 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C 45 s, followed by a final extension at 72 °C for 10 min. The purified PCR products were cloned into a pMD-18T vector (Takara, Dalian, China) and subsequently sequenced by Sangon Company (Shanghai, China).

For quantitative real-time PCR analysis, the total RNA of embryo eyes on EDD 5 was extracted using TRIzol reagent (Takara, Kyoto, Japan) according to the manufacturer's protocol. Total RNA (3 μg) was reverse transcribed into cDNA at 42°C for 1 h in 20 μl of reaction mixture containing reverse transcriptase with oligo(dT)15 primer (Tiangen, Beijing, China). The cDNA was then determined using Maxima™ SYBR Green/Fluorescein qPCR Master Mix (Fermentas, Hanover, MD, USA) via the IQTM5 real-time PCR detection system (Bio-Rad, Hercules, CA, USA). The final products were analyzed by the cycle threshold method. The forward and reverse primers, respectively, for Pax6, Glut1, Six3, Otx2 and β-actin were as follows: Pax6, 5′-GCTATGACACCTACAC-3′ and 5′-ACTTGAACTGGAACTG-3′; Glut1, 5′-TCTCTGTCGCCATCTTCTCG-3′ and 5′-TGGTGAGGCCAGAATACAGG-3′; Six3, 5′-CCAGTGTTTCCAGTTTGA-3′ and 5′-TTGTTGTTGTTGTTGTGATT-3′; Otx2, 5′-ACCTCAACCAGTCTCC-3′ and 5′-TCCAAGCAGTCAGCAT-3′; and β-actin, 5′-TACCTTCAACTCCATCA-3′ and 5′-CTCCAATCCAGACAGA-3′.