4d electroporation system

Manufactured by Lonza

Sourced in Switzerland

The 4D electroporation system is a laboratory equipment designed for the delivery of various molecules, such as DNA, RNA, and proteins, into cells. It utilizes a combination of electrical pulses and other physical parameters to facilitate the uptake of these molecules by the target cells. The core function of the 4D electroporation system is to enable efficient and controlled transfection of cells for research and experimental purposes.

Automatically generated - may contain errors

Lab products found in correlation

Fs dna library prep kit, by New England Biolabs (1 mentions)

Spelling variants of this product

4D 96-well electroporation system (8 citations)

4 protocols using 4d electroporation system

Non-Viral Gene-Edited CAR-T Cell Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Electroporation was performed 2–3 d after T cell stimulation. For preparation of non-viral, gene-specific targeted CAR-T cells from healthy donors and some patients, the procedure was conducted following the manufacturer’s instructions using a Lonza 4D electroporation system. In brief, 2.5 × 10⁶ to 1.5 × 10⁷ prewashed T cells were resuspended in 100 μl electroporation buffer P3. Meanwhile, RNPs were prepared, followed by mixture with the DNA template (1.5–20 μg). Cells in electroporation buffer were then added and moved into electroporation cuvettes. Programme EO115 was chosen for electroporation. After electroporation, cells were immediately supplemented with prewarmed medium and transferred out of the electroporation cuvettes.
To prepare PD1-19bbz cells for some patients, we followed the manufacturer’s instructions using the GT Flow Transfection System (MaxCyte). In brief, prewashed T cells were resuspended in MaxCyte electroporation buffer. Meanwhile, RNPs were prepared, followed by mixture with the DNA template. Cells in electroporation buffer were then added and moved into a static processing assembly (CL-1.1). After electroporation, cells were transferred for recovery and then added to culture medium. The reaction conditions were scaled up according to those used in the Lonza 4D electroporation system.

Zhang J., Hu Y., Yang J., Li W., Zhang M., Wang Q., Zhang L., Wei G., Tian Y., Zhao K., Chen A., Tan B., Cui J., Li D., Li Y., Qi Y., Wang D., Wu Y., Li D., Du B., Liu M, & Huang H. (2022). Non-viral, specifically targeted CAR-T cells achieve high safety and efficacy in B-NHL. Nature, 609(7926), 369-374.

+ Open protocol

+ Expand

Quantifying Off-Target Effects of CRISPR-Cas9 in HEK293T Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

To assay off-target sites, HEK293T cells were nucleofected with precomplexed RNP consisting of 104 pmol of the indicated protein and 120 pmol sgRNA using the Lonza 4D electroporation system. In parallel, cells were cotransfected with 5 pmol annealed double stranded oligodeoxynucleotide (dsODN) as described.^{39 (link)} After 72 h, cells were trypsinized and genomic DNA (gDNA) extracted using the PureLink gDNA extraction kit and quantified. Four hundred nanograms of high-molecular-weight gDNA was fragmented, end-repaired, and ligated using the NEB FS DNA Library Prep Kit. Fragments between 350 and 600 bp were amplified to enrich for dsODN-proximal regions using dsODN-specific primers in both the positive and negative orientations. Resulting libraries were amplified for NGS on Illumina MiSeq and sequenced as 2 × 150 paired end reads. Reads were analyzed using a modified guideseq software package (adapted from http://github.com/aryeelab/guideseq). The Venn diagrams for Supplementary Figure S12 were visualized with BioVenn.^{40 (link)}

Alexander L.M., Aliaga Goltsman D.S., Liu J., Lin J.L., Temoche-Diaz M.M., Laperriere S.M., Neerincx A., Bednarski C., Knyphausen P., Cohnen A., Albers J., Gonzalez-Osorio L., Fregoso Ocampo R., Oki J., Devoto A.E., Castelle C.J., Lamothe R.C., Cost G.J., Butterfield C.N., Thomas B.C, & Brown C.T. (2023). Novel and Engineered Type II CRISPR Systems from Uncultivated Microbes with Broad Genome Editing Capability. The CRISPR Journal, 6(3), 261-277.

+ Open protocol

+ Expand

Efficient CRISPR T-cell Genome Editing

Check if the same lab product or an alternative is used in the 5 most similar protocols

mRNA and crRNA were electroporated 48 h after initial T-cell stimulation, de-beaded cells were centrifuged for 10 min at 90 g, aspirated, and resuspended in the Lonza electroporation buffer P3 using 20 µL buffer per 1 million cells. For optimal editing, T cells were electroporated per well using a Lonza 4D electroporation system with pulse code EH115. Unless otherwise indicated, 2 µL mRNAs (50, 120, 120, 120, 140, 120 ng of cas3, cas5b, cas6b, cas7b, cas8b, cas11b) were electroporated, along with 2 µg crRNA. Immediately after electroporation, 80 µL of pre-warmed media was added to each well, and cells were allowed to rest for 10 min at 37 °C in a cell culture incubator while remaining in the electroporation cuvettes. After 10 min, cells were moved to 24-well tissue culture plates.

Lu M., Yu C., Zhang Y., Ju W., Ye Z., Hua C., Mao J., Hu C., Yang Z, & Xiao Y. (2024). Structure and genome editing of type I-B CRISPR-Cas. Nature Communications, 15, 4126.

+ Open protocol

+ Expand

CRISPR-Cas9 Electroporation Protocol for T Cell Editing

Check if the same lab product or an alternative is used in the 5 most similar protocols

CRISPR-Cas9 crRNA and tracrRNA were chemically synthesized by IDT (Coralville, Iowa, United States) and mixed at a ratio of 1:1, followed by incubation at 95 °C for 5 min, and then allowed to slowly cool to room temperature to provide annealed single guide RNA (sgRNA). The following sgRNA targeting sequences were used in our study: TRAC-sgRNA-1, AGAGTCTCTCAGCTGGTACA; TRAC-sgRNA-2, TGTGCTAGACATGAGGTCTA; TRAC-sgRNA-3, ACAAAACTGTGCTAGACATG; TRAC-sgRNA-4, TCAGGGTTCTGGATATCTGT. S.p. HiFi Cas9 Nuclease V3 was purchased from IDT (Coralville, IA). Cas9 ribonucleoproteins (RNPs) were produced by complexing sgRNA and spCas9 for 10 min at 25 °C, and electroporated immediately after complexing.
Electroporation was performed using the Lonza 4D electroporation system (Basel, Switzerland) per the manufacturer's instructions. For 20 μL Nucleocuvette Strips, 2 × 10⁶ cells resuspended in electroporation buffer were mixed with the RNP complex (containing 80 pmol Cas9 and 80 pmol sgRNA) and transferred to a cuvette for electroporation. After electroporation, pre-warmed 100 μL of media was added to the cuvette immediately, and the cells were incubated at 37 °C for 15 min. The electroporated cells were then resuspended in pre-warmed media containing FBS and cytokines, as described above, and transferred away from electroporation cuvettes.

Pan H., Yang X., Wang J., Liang H., Jiang Z., Zhao L., Wang Y., Liang Z., Shen X., Lin Q., Liang Y., Yang J., Lu P., Zhu Y., Li M., Wang P., Xu J., Lu H, & Zhu H. (2023). Allogeneic gene-edited HIV-specific CAR-T cells secreting PD-1 blocking scFv enhance specific cytotoxic activity against HIV Env+ cells invivo. Virologica Sinica, 38(2), 285-295.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!