Dual luciferase reporter gene assay kit

A549 human lung cancer cells (Gefen Biotechnology. Co., LTD, Shanghai, China) were transfected with the wild type BRD4 3’untranslated region (UTR) and mutant BRD4 3’UTR, which were cloned into p-miR-GLO plasmid (Fenghuishengwu, Changsha, China), together with microRNA-608 mimics or negative control (NC) mimics using the Lipofectamine™ 2000 (Thermo Fisher Scientific, Inc., Waltham, MA, USA). After incubation for 4 h at 37°C, the luciferase activities were measured by means of a dual-luciferase reporter gene assay kit (Yeasen Biotechnology Co., Ltd, Shanghai, China).

The various reporter constructs were co-transfected with Renilla luciferase vector into the cells. After 48 h, cells were lysed and activities of firefly luciferase and Renilla luciferase were analyzed Dual Luciferase Reporter Gene Assay Kit (11402ES60, YEASEN, China) according to the manufacturer’s instruction. All the results are presented as average value of triplicates ± SD.

The Dual Luciferase Reporter Gene Assay Kit (Yeasen, Cat. No. 11402ES60) was used for this experiment. A total of 5 × 10⁵ duck embryonic fibroblasts (DEFs) were subcultured in a 24-well plate. miR-24 mimics (5′-GGCTCAGTTCAGCAGGAACA-3′) were synthesized by TSINGKE (Shanghai, China), and transfected into DEFs. A 3′ UTR sequence of Gli3 and Magi1, as well as 2 miR-24-targeted sequences “AGGAGTTCCTTCAATCCTGGGCCT” (L1, 680–709) and “GTATGATCCTGAAATGGCAGCTGAGTCC” (L3, 1218–1245) of HN10 transcripts were respectively cloned into the downstream of the pGL3 firefly luciferase report vector (Promega, Madison, WI, USA). Additionally, these two miR-24 targeted sequences were also in vitro synthesized by TSINGKE. Vectors of pGL3 and phRL-TK (Rinilla luciferase) were co-transfected into DEFs using Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s protocol. After HN10 or JDm10 induction for 12 h, the culture medium was removed, washed by PBS 3 times, added to 100 μL lysate for 30 min at room temperature and then mixed with 50 μL luciferase assay reagent II buffer. The intensity of firefly and rinilla luciferase was measured by a Multiskan FC microplate reader. The ratio of firefly and rinilla luciferase was used to evaluate the transcription activity.

Luciferase activity was measured using the Dual Luciferase Reporter Gene Assay Kit (Yeasen, Shanghai, China). The firefly luciferase activity was normalized to the Renilla luciferase activity (firefly luciferase/Renilla luciferase), and expression is presented as relative luciferase activity.

Binding site of CEBPD to the VAMP3 promoter was predicted from Jaspar (http://jaspar.genereg.net/). Wild-type (WT) VAMP3 or mutant-type (MUT) VAMP3 promoter sequence was inserted into pGL3-Basic luciferase reporter vectors. Human embryonic kidney (HEK) 293 T cells were seeded into 96-well plates. When the cell confluence reached 60%, they were transfected with sh-CEBPD along with the constructed reporter vectors using Lipofectamine 3000 (Thermo Fisher Scientific). After 48 h, the luciferase activity in cells was analyzed by the Dual Luciferase Reporter Gene Assay Kit (11402ES60, YEASEN Biotechnology Co. Ltd., Shanghai, China).

The AcbHLH144 ORF fragment was fused to pGreen II 62-SK vector to obtain the effector and the Ac4CL5 promoter fragment was fused to pGreen II 0800-LUC vector to construct the reporter. Agrobacterium GV3101 (pSoup) including the effector and reporter was evenly mixed in a volume ratio of 8:2, and the mixture was co-infiltrated into the leaves of tobacco. The combination (pGreen II 62-SK + ProAc4CL5:LUC) was applied to the control group. Firefly and Renilla luciferases were determined 72 h after injection using a Dual Luciferase Reporter Gene Assay Kit (Yeasen, Shanghai, China). Primers for the DLR assay are shown in Supplementary Data Table S1.