Log In Sign up
The largest database of trusted experimental protocols

Taqman rna to ct 1 step kit

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in United States, Germany, United Kingdom, Lithuania

The TaqMan RNA-to-CT 1-Step Kit is a laboratory product designed for the quantitative detection and analysis of RNA. The kit provides a streamlined workflow for reverse transcription and real-time PCR amplification in a single reaction, enabling efficient and reliable RNA quantification.

Automatically generated - may contain errors

Lab products found in correlation

Taqman gene expression assay, by Thermo Fisher Scientific (61 mentions) Rneasy mini kit, by Qiagen (60 mentions) Steponeplus real time pcr system, by Thermo Fisher Scientific (33 mentions) Trizol reagent, by Thermo Fisher Scientific (31 mentions) Purelink rna mini kit, by Thermo Fisher Scientific (30 mentions) Taqman probe, by Thermo Fisher Scientific (26 mentions) Viia 7 real time pcr system, by Thermo Fisher Scientific (24 mentions) Magmax mirvana total rna isolation kit, by Thermo Fisher Scientific (21 mentions) Kingfisher flex extraction robot, by Thermo Fisher Scientific (20 mentions) Magna lyser instrument, by Roche (20 mentions) Trizol, by Thermo Fisher Scientific (18 mentions) Rneasy kit, by Qiagen (12 mentions) Qiaamp viral rna mini kit, by Qiagen (11 mentions) Nanodrop spectrophotometer, by Thermo Fisher Scientific (11 mentions) Quantstudio 6 flex real time pcr system, by Thermo Fisher Scientific (11 mentions) Nanodrop 2000, by Thermo Fisher Scientific (9 mentions) Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (9 mentions) Rneasy plus mini kit, by Qiagen (8 mentions) Rna blue, by Top-Bio (8 mentions) Nanodrop, by Thermo Fisher Scientific (8 mentions)

Spelling variants of this product

TaqMan® RNA-to-CTTM 1-Step Kit (21 citations) TaqMan kits (18 citations)

351 protocols using taqman rna to ct 1 step kit

1

Lentiviral Transduction and Knockdown of FURIN in NPCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
pLKO.1 - TRC control was a gift from David Root (Addgene plasmid # 10879)76 . A bacterial glycerol stock containing the LV-FURIN-shRNA plasmid was purchased from Sigma (SHCLNG-TRCN0000262167). High-titer lentiviral supernatant was generated by co-transfection of shRNA expression vector together with psPAX2 and pMD2.G to package letivirus particles in HEK-293T cells. psPAX2 (Addgene plasmid # 12260) and pMD2.G (Addgene plasmid # 12259) were gifts from Didier Trono. Lentiviral supernatant was concentrated by centrifugation at 19,300 × g for 2hr at 4°C and resuspended in NPC media. Viral titer was determined using a qPCR lentiviral titration kit (Applied Biological Material Inc. - LV900) and TaqMan® RNA-to-Ct™ 1-Step Kit (ThermoFisher Scientific – 4392938). NPC transduction was performed by addition of lentiviral particals to NPCs at an MOI of 0.5–1 followed by centrifugation of plate at 1,000 × g for 1hr at RT then incubation of NPCs at 37°C for an additional 6 hours. 48hr after infection, transduced cells were selected for with 1µg/mL puromycin for 48hr. FURIN knockdown was validated by qPCR using TaqMan® RNA-to-Ct™ 1-Step Kit (ThermoFisher Scientific – 4392938).
Fromer M., Roussos P., Sieberts S.K., Johnson J.S., Kavanagh D.H., Perumal T.M., Ruderfer D.M., Oh E.C., Topol A., Shah H.R., Klei L.L., Kramer R., Pinto D., Gümüş Z.H., Cicek A.E., Dang K.K., Browne A., Lu C., Xie L., Readhead B., Stahl E.A., Parvizi M., Hamamsy T., Fullard J.F., Wang Y.C., Mahajan M.C., Derry J.M., Dudley J., Hemby S.E., Logsdon B.A., Talbot K., Raj T., Bennett D.A., De Jager P.L., Zhu J., Zhang B., Sullivan P.F., Chess A., Purcell S.M., Shinobu L.A., Mangravite L.M., Toyoshiba H., Gur R.E., Hahn C.G., Lewis D.A., Haroutunian V., Peters M.A., Lipska B.K., Buxbaum J.D., Schadt E.E., Hirai K., Roeder K., Brennand K.J., Katsanis N., Domenici E., Devlin B, & Sklar P. (2016). Gene Expression Elucidates Functional Impact of Polygenic Risk for Schizophrenia. Nature neuroscience, 19(11), 1442-1453.
+ Open protocol
+ Expand
2

Lentiviral Transduction and Knockdown of FURIN in NPCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
pLKO.1 - TRC control was a gift from David Root (Addgene plasmid # 10879)76 . A bacterial glycerol stock containing the LV-FURIN-shRNA plasmid was purchased from Sigma (SHCLNG-TRCN0000262167). High-titer lentiviral supernatant was generated by co-transfection of shRNA expression vector together with psPAX2 and pMD2.G to package letivirus particles in HEK-293T cells. psPAX2 (Addgene plasmid # 12260) and pMD2.G (Addgene plasmid # 12259) were gifts from Didier Trono. Lentiviral supernatant was concentrated by centrifugation at 19,300 × g for 2hr at 4°C and resuspended in NPC media. Viral titer was determined using a qPCR lentiviral titration kit (Applied Biological Material Inc. - LV900) and TaqMan® RNA-to-Ct™ 1-Step Kit (ThermoFisher Scientific – 4392938). NPC transduction was performed by addition of lentiviral particals to NPCs at an MOI of 0.5–1 followed by centrifugation of plate at 1,000 × g for 1hr at RT then incubation of NPCs at 37°C for an additional 6 hours. 48hr after infection, transduced cells were selected for with 1µg/mL puromycin for 48hr. FURIN knockdown was validated by qPCR using TaqMan® RNA-to-Ct™ 1-Step Kit (ThermoFisher Scientific – 4392938).
Fromer M., Roussos P., Sieberts S.K., Johnson J.S., Kavanagh D.H., Perumal T.M., Ruderfer D.M., Oh E.C., Topol A., Shah H.R., Klei L.L., Kramer R., Pinto D., Gümüş Z.H., Cicek A.E., Dang K.K., Browne A., Lu C., Xie L., Readhead B., Stahl E.A., Parvizi M., Hamamsy T., Fullard J.F., Wang Y.C., Mahajan M.C., Derry J.M., Dudley J., Hemby S.E., Logsdon B.A., Talbot K., Raj T., Bennett D.A., De Jager P.L., Zhu J., Zhang B., Sullivan P.F., Chess A., Purcell S.M., Shinobu L.A., Mangravite L.M., Toyoshiba H., Gur R.E., Hahn C.G., Lewis D.A., Haroutunian V., Peters M.A., Lipska B.K., Buxbaum J.D., Schadt E.E., Hirai K., Roeder K., Brennand K.J., Katsanis N., Domenici E., Devlin B, & Sklar P. (2016). Gene Expression Elucidates Functional Impact of Polygenic Risk for Schizophrenia. Nature neuroscience, 19(11), 1442-1453.
+ Open protocol
+ Expand
3

Isolation and Analysis of Lung Dendritic Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
After total lung leukocyte preparation was performed, cells were resuspended up to 107 cells in 1mL MACS buffer (Miltenyi Biotec, San Diego, CA), incubated with 100μL of CD11c magnetic microbeads (Miltenyi Biotec, San Diego, CA) and isolated via a quadroMACS magnet in a LS column (Miltenyi Biotec, San Diego, CA). Cells were then counted via a hemacytometer then cytokine measurements were performed.
Total RNA was obtained from isolated cells, or whole lung tissue via Trizol extraction following the manufacturer’s protocol. RNA concentration was normalized between samples and qRT-PCR was performed on an ABI StepOnePlus real-time thermocycler (Thermo-Fisher, Waltham, MA) using a TaqMan® RNA-to-Ct™ 1-Step Kit (Thermo-Fisher, Waltham, MA) following the manufacturer’s protocol. All Primers and probes used in this study are listed in Table1.
Gurczynski S.J., Nathani N., Warheit-Niemi H.I., Hult E.M., Podsiad A., Deng J., Zemans R.L., Bhan U, & Moore B.B. (2018). CCR2 mediates increased susceptibility to post-H1N1 bacterial pneumonia by limiting dendritic cell induction of IL-17. Mucosal immunology, 12(2), 518-530.
+ Open protocol
+ Expand
4

Quantifying Gene Expression in Mouse Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols
qPCR was performed as previously described [43]. Mouse skin samples and BMDMs were homogenized using TRIzol reagent (Thermo Fisher Scientific, 15596026) to extract total RNA according to the manufacturer’s instructions and quantified using the NanoDrop 2000 (Thermo Scientific, Carlsbad, CA, USA). RNA (100 ng) was required for reverse transcriptase–PCR analysis using TaqMan Gene Expression Assays and the Taqman RNA-to-CT 1-Step kit (Thermo Fisher Scientific, 4392938) for quantification of Tnf, Nos2, Mmp9, Pparg, Vdr, Arg1, Cd86 (Thermo Fisher Scientific, Mm99999068_m1, Mm01309902_m1, Mm00442991_m1, Mm01184322_m1, Mm00437297_m1, Mm00475988_m1, Mm00444543_m1), Klf4 (Integrated DNA Technologies, 187934787, 187934788) mRNA expression. Samples were analyzed using a Step-One System (Applied Biosystems, Grand Island, NY) based on manufacturer’s recommendations. Gene expression was expressed as fold changes normalized to the 18S (Thermo Fisher Scientific, Hs99999901_s1) RNA housekeeping gene.
Das L.M., Binko A.M., Traylor Z.P., Peng H, & Lu K.Q. (2019). Vitamin D improves sunburns by increasing autophagy in M2 macrophages. Autophagy, 15(5), 813-826.
+ Open protocol
+ Expand
5

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Wild type A549 and DOCK5-ko clones (c20, c25, c28, and c41) were infected as described above, and extracted RNA was used as a template for RT-qPCR. The RT-qPCR was performed using the TaqMan® RNA-to-Ct™ 1-Step Kit and the TaqMan® Gene Expression Assays (Thermo Fisher Scientific, Inc.). The assay IDs are Hs01103582_s1 for JUN, Hs01105383_g1 for VAMP5, Hs00158122_m1 for ISG20, Hs00353740 and Hs99999905_m1 for NR3C1, Hs00227848_m1 for DOCK5, and Hs00213893_m1 for WBSCR22. GAPDH was used as an internal control for the quantification because its level is unchanged upon virus infection. The 2−ΔΔCT method was used to analyze the relative changes in gene expression.58 (link)
Forst C.V., Zhou B., Wang M., Chou T.W., Mason G., Song W.M., Schadt E., Ghedin E, & Zhang B. (2017). Integrative gene network analysis identifies key signatures, intrinsic networks and host factors for influenza virus A infections. NPJ Systems Biology and Applications, 3, 35.
+ Open protocol
+ Expand
6

SARS-CoV-2 N Gene RNA Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mouse tissues were weighed and homogenized with zirconia beads in a MagNA Lyser instrument (Roche Life Science) in 1000 μL of DMEM media supplemented with 2% heat-inactivated FBS. Tissue homogenates were clarified by centrifugation at 10,000 rpm for 3 min and RNA was extracted from 50uL of supernatant using the MagMax mirVana Total RNA isolation kit (Thermo Scientific) on the Kingfisher Flex extraction robot (Thermo Scientific). RNA was reverse transcribed and amplified using the TaqMan RNA-to-CT 1-Step Kit (ThermoFisher). Reverse transcription was carried out at 48°C for 15 min followed by 2 min at 95°C. Amplification was accomplished over 50 cycles as follows: 95°C for 15 s and 60°C for 1 min. Copies of SARS-CoV-2 N gene RNA in samples were determined using a previously published assay. Briefly, a TaqMan assay was designed to target a highly conserved region of the N gene (Forward primer: ATGCTGCAATCGTGCTACAA; Reverse primer: GACTGCCGCCTCTGCTC; Probe: /56-FAM/TCAAGGAAC/ZEN/AACATTGCCAA/3IABkFQ/). This region was included in an RNA standard to allow for copy number determination down to 10 copies per reaction. The reaction mixture contained final concentrations of primers and probe of 500 and 100 nM, respectively.
Johnson B.A., Xie X., Bailey A.L., Kalveram B., Lokugamage K.G., Muruato A., Zou J., Zhang X., Juelich T., Smith J.K., Zhang L., Bopp N., Schindewolf C., Vu M., Vanderheiden A., Winkler E.S., Swetnam D., Plante J.A., Aguilar P., Plante K.S., Popov V., Lee B., Weaver S.C., Suthar M.S., Routh A.L., Ren P., Ku Z., An Z., Debbink K., Diamond M.S., Shi P.Y., Freiberg A.N, & Menachery V.D. (2021). Loss of Furin Cleavage Site Attenuates SARS-CoV-2 Pathogenesis. Nature, 591(7849), 293-299.
+ Open protocol
+ Expand
7

SARS-CoV-2 N Gene Quantification

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Tissues were weighed and homogenized with zirconia beads in a MagNA Lyser instrument (Roche Life Science) in 1,000 μL of DMEM media supplemented with 2% heat-inactivated FBS. Tissue homogenates were clarified by centrifugation at 10,000 rpm for 5 min and stored at −80°C. RNA was extracted using the MagMax mirVana Total RNA isolation kit (Thermo Scientific) on a Kingfisher Flex extraction robot (Thermo Scientific). RNA was reverse transcribed and amplified using the TaqMan RNA-to-CT 1-Step Kit (ThermoFisher). Reverse transcription was carried out at 48°C for 15 min followed by 2 min at 95°C. Amplification was accomplished over 50 cycles as follows: 95°C for 15 s and 60°C for 1 min. Copies of SARS-CoV-2 N gene RNA in samples were determined using a previously published assay (Case et al., 2020 (link); Hassan et al., 2020 (link)). Briefly, a TaqMan assay was designed to target a highly conserved region of the N gene (Forward primer: ATGCTGCAATCGTGCTACAA; Reverse primer: GACTGCCGCCTCTGCTC; Probe: /56-FAM/TCAAGGAAC/ZEN/AACATTGCCAA/3IABkFQ/). This region was included in an RNA standard to allow for copy number determination down to 10 copies per reaction. The reaction mixture contained final concentrations of primers and probe of 500 and 100 nM, respectively.
Case J.B., Chen R.E., Cao L., Ying B., Winkler E.S., Johnson M., Goreshnik I., Pham M.N., Shrihari S., Kafai N.M., Bailey A.L., Xie X., Shi P.Y., Ravichandran R., Carter L., Stewart L., Baker D, & Diamond M.S. (2021). Ultrapotent miniproteins targeting the SARS-CoV-2 receptor-binding domain protect against infection and disease. Cell Host & Microbe, 29(7), 1151-1161.e5.
+ Open protocol
+ Expand
8

SARS-CoV-2 N Gene RNA Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols
Tissues were weighed and homogenized with zirconia beads in a MagNA Lyser instrument (Roche Life Science) in 1 mL of DMEM medium supplemented with 2% heat-inactivated FBS. Tissue homogenates were clarified by centrifugation at approximately 10,000 × g for 5 min and stored at −80 °C. RNA was extracted using the MagMax mirVana Total RNA isolation kit (Thermo Fisher Scientific) on the Kingfisher Flex extraction robot (Thermo Fisher Scientific). RNA was reverse transcribed and amplified using the TaqMan RNA-to-CT 1-Step Kit (Thermo Fisher Scientific). Reverse transcription was carried out at 48 °C for 15 min followed by 2 min at 95 °C. Amplification was accomplished over 50 cycles as follows: 95 °C for 15 s and 60 °C for 1 min. Copies of SARS-CoV-2 N gene RNA in samples were determined using a previously published assay42 (link). Briefly, a TaqMan assay was designed to target a highly conserved region of the N gene (Forward primer: ATGCTGCAATCGTGCTACAA; Reverse primer: GACTGCCGCCTCTGCTC; Probe: /56-FAM/TCAAGGAAC/ZEN/AACATTGCCAA/3IABkFQ/). This region was included in an RNA standard to allow for copy number determination down to 10 copies per reaction. The reaction mixture contained final concentrations of primers and probe of 500 and 100 nM, respectively.
Case J.B., Mackin S., Errico J.M., Chong Z., Madden E.A., Whitener B., Guarino B., Schmid M.A., Rosenthal K., Ren K., Dang H.V., Snell G., Jung A., Droit L., Handley S.A., Halfmann P.J., Kawaoka Y., Crowe JE J.r., Fremont D.H., Virgin H.W., Loo Y.M., Esser M.T., Purcell L.A., Corti D, & Diamond M.S. (2022). Resilience of S309 and AZD7442 monoclonal antibody treatments against infection by SARS-CoV-2 Omicron lineage strains. Nature Communications, 13, 3824.
+ Open protocol
+ Expand
9

SARS-CoV-2 N Gene RNA Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted using the MagMax mirVana Total RNA isolation kit (Thermo Fisher Scientific) on the Kingfisher Flex extraction robot (Thermo Fisher Scientific). RNA was reverse transcribed and amplified using the TaqMan RNA-to-CT 1-Step Kit (Thermo Fisher Scientific). Reverse transcription was carried out at 48°C for 15 min followed by 2 min at 95°C. Amplification was accomplished over 50 cycles as follows: 95°C for 15 sec and 60°C for 1 min. Copies of SARS-CoV-2 N gene RNA in samples were determined using a published assay48 (link).
Scheaffer S.M., Lee D., Whitener B., Ying B., Wu K., Jani H., Martin P., Amato N.J., Avena L.E., Berrueta D.M., Schmidt S.D., O’Dell S., Nasir A., Chuang G.Y., Stewart-Jones G., Koup R.A., Doria-Rose N.A., Carfi A., Elbashir S.M., Thackray L.B., Edwards D.K, & Diamond M.S. (2022). Bivalent SARS-CoV-2 mRNA vaccines increase breadth of neutralization and protect against the BA.5 Omicron variant. bioRxiv.
+ Open protocol
+ Expand
10

RNA Expression Analysis in LX-2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from six biological replicates from treated and untreated LX-2 cells using the RNeasy Mini Kit (Qiagen). All RNA preparations were diluted to 5 μg/μl. The Taqman RNA-to-Ct 1-Step kit (ThermoFisher Scientific) was used to convert RNA to cDNA according to the protocol, followed by RT-qPCR analysis using Taqman Gene Expression Assays and the QuantStudio 6 Flex (Life Technologies; Carlsbad, CA). We used glyceraldehyde 3-phosphate dehydrogenase (GAPDH) for normalization of expression and the -ΔΔCt method to determine the fold-change of RNA expression. A two-tailed t-test was used to assess statistical significance. Primer sequences for all qPCR assays are available upon request.
Gerhard G.S., Davis B., Wu X., Hanson A., Wilhelmsen D., Piras I.S., Still C.D., Chu X., Petrick A.T, & DiStefano J.K. (2020). Differentially expressed mRNAs and lncRNAs shared between activated human hepatic stellate cells and nash fibrosis. Biochemistry and Biophysics Reports, 22, 100753.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!