Superscript 3 cdna synthesis kit

The conidia were inoculated in 200 mL LTY medium with 0, 0.5 and 3 mM Cu, respectively, and cultured for 3 d at 32 °C in an incubator-shaker at 200 rpm. The mycelial cultures resulting from different conditions were separately used for extraction of the total RNA by using the TruSeq Stranded Total RNA LT-(with Ribo-Zero^TM Gold)-Set B according to the manufacturer’s protocol. The quality and integrity of the RNA sample were controlled by Bioanalyzer 2100 (Agilent, Germany) and by running agarose gel, respectively. A 5-μg aliquot of mRNA was captured from each kind of total RNA sample by Dynabeads Oligo(dT) (Life technologies, USA), sheared to fragments of ~200 bp, and then reverse-transcribed into cDNAs by using the SuperScriptIII cDNA Synthesis Kit (Life technologies, USA). The cDNAs were end-repaired by ligation of an A base followed by ligating to Illumina sequencing Truseq V2 RNA Adapter which was from the TruSeq RNA LT V2 Sample Prep Kit (Illumina, Sandiego). After the end modification, the cDNAs were amplified by 12 thermal cycles of PCR and then used for construction of the cDNA library by using the TruSeq RNA LT V2 Sample Prep Kit (Illumina, Sandiego).

RNA extraction and real-time quantitative PCR (qPCR) were carried out using procedures that we had previously described (12 (link)). Briefly, total RNA was extracted using a PureLink RNA minikit (Life Technologies). DNase (Ambion)-treated RNA samples were analyzed on a denaturing formaldehyde agarose gel for assessing purity, quality, and concentration. A SuperScript III cDNA synthesis kit (Life Technology) was used for the first-strand cDNA synthesis following the manufacturer’s protocols. Constitutively expressed housekeeping gene TEF1 was used as an endogenous control for the normalization of expression of the other genes studied.

Total RNA was extracted from mouse dendritic cells in PureLink™ RNA Mini Kit (Life Technologies, Germany) according to the manufacturer’s instructions54 (link). Total RNA was used for cDNA synthesis using Superscript III cDNA Synthesis kit (Life technologies, Germany) according to the manufacturer’s instructions. Polymerase chain reaction (PCR) amplification of the respective genes were set up in a total volume of 10 μl using 10 ng of cDNA, 250 nM forward and reverse primer and 2x qPCR Master Mix KAPA SYBR Green (PeqLab, Erlangen, Germany) according to the manufacturer’s protocol. Cycling conditions were used as follows: initial denaturation at 95 °C for 3 min, followed by 40 cycles of 95 °C for 10 sec, 60 °C for 1 min and then melting curve analysis protocol was performed. For the amplification the following primers were used (5′->3′orientation): Atp1α1 F: AGCATCAATGCGGAGGATGT, R: TATCCACCTTGCAGCCGTTT and Gapdh; F: CGT CCC GTA GAC AAA ATG GT; R: TTG ATG GCA ACA ATC TCC AC.
Specificity of PCR products was confirmed by analysis of melting curves. Real-time PCR amplifications were performed on a CFX96 Real-Time System (Bio-Rad). All experiments were done in duplicate. Amplification of the house-keeping gene GAPDH was performed to standardize the amount of sample RNA. Relative quantification of gene expression was achieved using the ^ΔΔct method as described earlier55 (link).

For qPCR, total RNA was extracted using the RNeasy Mini Kit (Qiagen). Residual DNA was removed by DNase digestion using the Turbo DNA-free kit (Ambion, Life Technologies). RNA (100 ng) was used to synthesize cDNA with the Superscript III cDNA Synthesis kit (Life Technologies). Each cDNA sample was tested in three technical replicates per plate using a minimum of 3 biological replicates. Experiments were carried out in a 7500 Real Time PCR System (Life Technologies) using the Power SYBR Green Master mix (Life Technologies). Reactions were carried out in a final volume of 25 µl in 96 well plates. S. mansoni cytochrome C oxidase I (GenBank AF216698) was used as the sample normalizing transcript [28] (link), [29] , as it has been shown to be highly and constitutively expressed in various S. mansoni life-cycle stages [30] (link), [27] (link) and GFP cDNA was used as endogenous control [31] (link). Two internal controls assessing both possible genomic DNA contaminations (no reverse transcriptase) and purity of the reagents (no cDNA) were included. The 2^−ΔΔCt method was used to measure transcript levels post-RNAi [32] (link). Transcript levels were expressed as percentage of difference compared to those following exposure to the schistosome- unspecific GFP dsRNA. Statistical analysis employed the Mann-Whitney U-test (p<0.05).