Viia 7 ruo software

Manufactured by Thermo Fisher Scientific

Sourced in United States

The ViiA 7 RUO software is a real-time PCR analysis software developed by Thermo Fisher Scientific. It is designed to enable the management, setup, and analysis of real-time PCR experiments.

Automatically generated - may contain errors

Lab products found in correlation

27 protocols using viia 7 ruo software

Quantitative Profiling of Mitochondrial and Cytosolic miRNAs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA isolated from mitochondria and cytosol of each hippocampal tissue was subjected to TaqMan® miRNA RT-qPCR array using Rodent Card A (Life Technologies). Because of the relatively low levels of mitochondrial RNA and the benefit of uniformity, a preamplification step using Megaplex^™ PreAmp Primers (Life Technologies) was carried out to enhance the detection ability for low-expression miRNAs. TaqMan® miRNA RT-qPCR array was performed as described previously (Wang et al., 2014 ). Briefly, equal amount of total RNA (50 ng) was reverse transcribed using the TaqMan® MicroRNA Reverse Transcription Kit with Megaplex^™ Primer Pools, Rodent Pool A (Life Technologies). The resulting cDNA was pre-amplified using Megaplex^™ PreAmp Primers, Rodent Pool A (Life Technologies) before performing RT-qPCR Array. PCR was carried out on the ViiA^™ 7 Real-Time PCR System and qPCR cycle threshold (Ct) raw data processed with ViiA 7 RUO software (Life Technologies).

Wang W.X., Visavadiya N.P., Pandya J.D., Nelson P.T., Sullivan P.G, & Springer J.E. (2015). Mitochondria-associated microRNAs in rat hippocampus following traumatic brain injury. Experimental neurology, 265, 84-93.

+ Open protocol

+ Expand

Genotyping Novel AR and TEX11 Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

Custom TaqMan® assays were developed for a novel non-coding SNP in the AR gene (AR_In4) located in the fourth intron, as well as 3 novel nsSNP spanning the Tex11 gene (Tex11_ r38k, Tex11_g297d, Tex11_ r696h). Primers and probes were developed using the Custom TaqMan® Array Design Tool, and are listed in Additional file 1 Table S1.
Genotyping was performed by allelic discrimination using custom TaqMan® SNP genotyping assays, following the manufacturer's instructions. Briefly, 5 μl PCR reactions were carried out containing 2.5 μl of TaqMan® Universal PCR Master Mix (Applied Biosystems, New Jersey, USA), 10 ng of DNA template and 0.25 μl of TaqMan® assay primers and FAM/VIC labelled probes by Applied Biosystems as Assays-by-Design™ (Applied Biosystems, Foster City, CA, USA). All thermal cycling experiments were performed in 384 well plates on a Gene Amp 9700 (Applied Biosystems). Amplification conditions consisted of 50°C for 2 min, 95°C for 10 min followed by 40 cycles of 95°C for 30 s and 60°C for 1 min, and finally 25°C until removed from the thermal cycler. End-point reads were then performed on the Applied Biosystems ViiA™ 7 Real-Time PCR System, and allelic discrimination analysis was performed using ViiA™ 7RUO software (Life Technologies, CA, USA).

Lyons R.E., Loan N.T., Dierens L., Fortes M.R., Kelly M., McWilliam S.S., Li Y., Bunch R.J., Harrison B.E., Barendse W., Lehnert S.A, & Moore S.S. (2014). Evidence for positive selection of taurine genes within a QTL region on chromosome X associated with testicular size in Australian Brahman cattle. BMC Genetics, 15, 6.

+ Open protocol

+ Expand

Normalization and Analysis of miRNA Array Data

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Raw PCR Ct values were first determined using ViiA 7 RUO software (Life Technologies) with the same parameter settings across all samples (threshold set at 0.15 with automatic baseline). Data corresponding to failed QC as determined by ViiA 7 RUO software were excluded from the analysis. In addition, miRNAs with a PCR Ct value >35 were considered as undetectable. DataAssist® software (Life Technologies) was then used to analyze miRNA array data. Different array data from cytosol and mitochondria fractions were normalized separately. The Global Mean Normalization method (Mestdagh et al., 2009 (link)) was applied to normalize the pooled dataset of both Naïve and TBI. The Ct values presented in this report, including the Supplemental data, are normalized data. The miRNA expression levels between treatments (TBI vs Naïve) or mitochondria versus cytosol fractions from naïve rat brain samples were expressed as fold changes using the following equation: fold change=2^ ^{−(Ct_TBI − Ct_Naive)}, or fold change=2^ ^{−(Ct_Mito − Ct_Cyto)}, and were evaluated using an unpaired Student t-test. Benjamini-Hochberg or permutation tests were used to control False Discovery Rate (FDR), and all significant data points (p<0.05) had a FDR< 5%. The data from the TaqMan® single-tube miRNA RT-qPCR assays were compared using unpaired student t-tests with a p<0.05 considered as statistically significant.

+ Open protocol

+ Expand

Detecting KIAA1549-BRAF Fusion in Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was purified from tissue section with RNeasy Micro Kit (Qiagen) according to the manufacturer’s recommendations. Hydrolysis probe assays to detect K-B exon junctions were designed according to Tian and colleagues and purchased from Life Technologies (Darmstradt, Germany) [15 (link)]. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA was used as internal control. PCR amplification was carried out on cDNA from 10 ng of RNA using AmpliTaq Gold DNA polymerase (Life Technologies). Reactions were in duplicate with incubation at 50 °C for 2 min, then 95 °C for 10 min, and then for 50 cycles of 95 °C for 15 s and 60 °C for 1 min. Fluorescence was recorded and cycles to threshold (CT) are calculated using ViiA7 RUO Software (Life Technologies). A reference of total RNA obtained from non-neoplastic cerebellum tissue sample (Stratagene, LA Jolla, CA) was used as negative control. The positive control for KIAA1549-BRAF was RNA with known breakdown junction, which was provided by Dr Jones in Heidelberg.

Pages M., Lacroix L., Tauziede-Espariat A., Castel D., Daudigeos-Dubus E., Ridola V., Gilles S., Fina F., Andreiuolo F., Polivka M., Lechapt-Zalcman E., Puget S., Boddaert N., Liu X.Q., Bridge J.A., Grill J., Chretien F, & Varlet P. (2015). Papillary glioneuronal tumors: histological and molecular characteristics and diagnostic value of SLC44A1-PRKCA fusion. Acta Neuropathologica Communications, 3, 85.

+ Open protocol

+ Expand

Quantifying CD22 mRNA Isoforms

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using the Qiagen RNeasy kit and reverse transcribed using SuperScript IV (Invitrogen; 18090010). Primers used for each CD22 mRNA isoform are listed in Supplementary Table S2. qRT-PCR was performed using PowerSYBR Green PCR Master Mix (Life Technologies). Reactions were performed on an Applied Biosystems Viia7 machine and analyzed with Viia7 RUO software (Life Technologies). When indicated, individual PCR products were gel purified (QIAquick Gel Extraction Kit; Qiagen) and Sanger sequenced.

Zheng S., Gillespie E., Naqvi A.S., Hayer K.E., Ang Z., Torres-Diz M., Quesnel-Vallières M., Hottman D.A., Bagashev A., Chukinas J., Schmidt C., Asnani M., Shraim R., Taylor D.M., Rheingold S.R., O'Brien M.M., Singh N., Lynch K.W., Ruella M., Barash Y., Tasian S.K, & Thomas-Tikhonenko A. (2022). Modulation of CD22 Protein Expression in Childhood Leukemia by Pervasive Splicing Aberrations: Implications for CD22-Directed Immunotherapies. Blood Cancer Discovery, 3(2), 103-115.

+ Open protocol

+ Expand

Comprehensive CD19 mRNA isoform analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using TRIzol reagent (Invitrogen). cDNAs were prepared with random hexamers using the High Capacity cDNA RT Kit (Life Technologies). CD19 mRNA isoforms were visualized in 1% agarose gels after semiquantitative PCR amplification of cDNA using Platinum Taq-polymerase (Invitrogen) following the manufacturer's instructions. Primers used for each CD19 mRNA isoform and expected amplicon sizes are listed in Supplementary Table S8. When required, individual bands were gel-purified (QIAquick Gel Extraction Kit; Qiagen) and Sanger sequenced. qRT-PCR was performed using PowerSYBR Green PCR Master Mix (Life Technologies) and gene-specific oligo pairs (Supplementary Table S9). Reactions were performed on an Applied Biosystems Viia7 machine and analyzed with Viia7 RUO software (Life Technologies).

Sotillo E., Barrett D.M., Black K.L., Bagashev A., Oldridge D., Wu G., Sussman R., Lanauze C., Ruella M., Gazzara M.R., Martinez N.M., Harrington C.T., Chung E.Y., Perazzelli J., Hofmann T.J., Maude S.L., Raman P., Barrera A., Gill S., Lacey S.F., Melenhorst J.J., Allman D., Jacoby E., Fry T., Mackall C., Barash Y., Lynch K.W., Maris J.M., Grupp S.A, & Thomas-Tikhonenko A. (2015). Convergence of Acquired Mutations and Alternative Splicing of CD19 Enables Resistance to CART-19 Immunotherapy. Cancer discovery, 5(12), 1282-1295.

+ Open protocol

+ Expand

Analyzing Drug-DNA Interactions by qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from HeLa cells using Qiagen RNasy mini kit (Qiagen). Reverse transcription was performed in 20 μl reaction mixture [Transcriptor Universal cDNA Master (Roche)] with 2.5 μg total RNA. The synthesized cDNA was diluted 1:10 before used as the template. β-Actin primers (5″- CTC TTC CAG CCT TCC TTC CT-3″ –F & 5″ -AGC ACT GTG TTG GCG TAC AG- 3″ -R) were used in real-time PCR (qPCR) assay. The 20 μl qPCR reaction mixture contained 2 μl template; 0.3 μl each of 1 mM forward and reverse primers; 10 μl PowerUp SYBR™ Green Master Mix (Thermo Fisher); 2 μl 0.1 mM compound (artemisinin or cisplatin) or DMSO; 5.4 μl ddH2O. The qPCR was conducted as following: an initial 2 min at 50°C, 10 min at 95°C; followed by 40 cycles of 15 s at 95°C and 1 min at 60°C. The last melting curve stage was conducted at 15 s at 95°C, 1 min at 60°C, 15 s at 95°C. The dissociation curve was analyzed using ViiA 7 RUO software (Life technology, Carlsbad, USA) to demonstrate the shift of melting curve due to the binding of the test compound to DNA molecules.

Kadioglu O., Chan A., Cong Ling Qiu A., Wong V.K., Colligs V., Wecklein S., Freund-Henni Rached H., Efferth T, & Hsiao W.L. (2017). Artemisinin Derivatives Target Topoisomerase 1 and Cause DNA Damage in Silico and in Vitro. Frontiers in Pharmacology, 8, 711.

+ Open protocol

+ Expand

Quantitative PCR Analysis Using ViiA 7 System

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantitative PCR was carried out using the ViiA™ 7 Real-Time PCR System (Life Technologies) and the FastStart SYBR Green Master mix (Roche, 04673492001). PCR was performed in 384 well plates with 10 µl under the following conditions: 95 °C for 15 min, followed by 40 cycles of 94 °C for 15 s, 61 °C for 30 s, and 72 °C for 30 s. Specificity was verified by a dissociation curve. Results were analyzed with ViiA7 RUO software (Life Technologies). Gene expression levels were normalized to GAPDH expression. Primer sequences are provided in Supplementary Table 2.

Esposito D., Pant I., Shen Y., Qiao R.F., Yang X., Bai Y., Jin J., Poulikakos P.I, & Aaronson S.A. (2022). ROCK1 mechano-signaling dependency of human malignancies driven by TEAD/YAP activation. Nature Communications, 13, 703.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Mechanosensitive Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantitative RT-PCR was performed using the ViiA™ 7 Real-Time PCR System (Life Technologies, Carlsbad, CA, USA) using the FastStart SYBR Green Master mix (Roche, Indianapolis, IN, USA). Primers were as follows: CTGF FW-CCAATGACAACGCCTCCTG, Rev-TGGTGCAGCCAGAAAGCTC; CYR61 FW- AGCCTCGCATCCTATACAACC, Rev- TTCTTTCACAAGGCGGCACTC; ANKRD1 FW- CACTTCTAGCCCACCCTGTGA, Rev- CCACAGGTTCCGTAATGATTT; YAP FW-TAGCCCTGCGTAGCCAGTTA, Rev TCATGCTTAGTCCACTGTCTGT, AMOT FW-ACTACCACCACCTCCAGTCA, Rev-ACAAGGTGACGACTCTCTGC; AMOTL1 FW-GCAGACAGGAAAACTGAGGA, REV-AAATGTGGTGGGAACAGAGA; AMOTL2 FW-GCTACTGGGGTAGCAACTGA, Rev-GAAGGCAGTGAGGAACTGAA; TNKS1 FW-GACCCAAACATTCGGAACAC, Rev-GCAGCTTCTAGGAGTTCGTCTT; TNKS2 FW-AACGAGTCAAGAGGCTGGTG, REV-TTCAACTACGTCTTTCCGCC; GAPDH FW- CTCTGCTCCTCCTGTTCGAC Rev- TTAAAAGCAGCCCTGGTGAC. PCR was performed in 384 well plates in 10 μl total volumes under the following conditions: 95°C for 15 min, followed by 40 cycles of 94°C for 15 sec, 61°C for 30 sec, and 72°C for 30 sec. Specificity was verified by a dissociation curve. Results were analyzed with ViiA7 RUO software (Life Technologies, Carlsbad, CA, USA). Gene expression levels were normalized to GAPDH expression.

Troilo A., Benson E.K., Esposito D., Garibsingh R.A., Reddy E.P., Mungamuri S.K, & Aaronson S.A. (2016). Angiomotin stabilization by tankyrase inhibitors antagonizes constitutive TEAD-dependent transcription and proliferation of human tumor cells with Hippo pathway core component mutations. Oncotarget, 7(20), 28765-28782.

+ Open protocol

+ Expand

Thermal Stability Assay of GlnRS Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols

Purified GlnRS (20μM) samples were mixed with the SYPRO-Orange dye (1:500 dilution; Sigma Aldrich) in a 4:1 ratio. Mixtures were dispensed into a 384-well microplate in triplicates and analyzed on the Vii^TM 7 Real-Time PCR System (Life Technologies) using the Melting Curve method with a continuous heating (0.075°C/s) from 25°C to 95°C. The melting curves were recorded in real time as change in fluorescence signal and analyzed using the ViiA^TM 7 RUO Software (Life Technologies).

Ognjenović J., Wu J., Matthies D., Baxa U., Subramaniam S., Ling J, & Simonović M. (2016). The crystal structure of human GlnRS provides basis for the development of neurological disorders. Nucleic Acids Research, 44(7), 3420-3431.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!