Px330 plasmid

Manufactured by Addgene

Sourced in United States

The PX330 plasmid is a CRISPR/Cas9 vector that enables targeted gene editing. It expresses the Cas9 endonuclease protein and allows for the insertion of a custom guide RNA sequence to direct Cas9 to the desired genomic target.

Automatically generated - may contain errors

Lab products found in correlation

46 protocols using px330 plasmid

Generation of dCas9 and dCas9-KRAB Vectors

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the gRNA expression vector, we use a pX332-original plasmid gifted from the laboratory of Joanna Wysocka (Standford)^{81 (link)}, which contains a mCherry expression cassette. The dCas9 and dCas9-KRAB expression vectors described in this study were generated on a backbone of Cas9 expression vector: pX330 plasmid (Addgene; plasmid 42230) by using In-Fusion cloning method. Both of the dCas9 and dCas9-KRAB genes were amplified from pHAGE EF1α dCas9-KRAB (Addgene; plasmid 50919) with PCR and cloned separately into the AgeⅠ and EcoRⅠ sites of pX330 plasmid, replacing the Cas9 ORF. The detailed information for primers can be found in Supplementary Table 7. All sgRNAs in this study were designed on CCTop-CRISPR/Cas9 target online predictor^{82 (link),83} and manually picked.

Zhang S., Plummer D., Lu L., Cui J., Xu W., Wang M., Liu X., Prabhakar N., Shrinet J., Srinivasan D., Fraser P., Li Y., Li J, & Jin F. (2022). DeepLoop robustly maps chromatin interactions from sparse allele-resolved or single-cell Hi-C data at kilobase resolution. Nature genetics, 54(7), 1013-1025.

+ Open protocol

+ Expand

CRISPR Guide Design and Plasmid Construction

Check if the same lab product or an alternative is used in the 5 most similar protocols

A web-based CRISPR design tool (http://crispr.mit.edu) was used for making RCP CRISPR constructs. The following CRISPR guides against RCP were used: fw- CACCGAAGTACGCCACCTCCGTGT, rev - CAAAACACGGAGGTGGCGTACTTC. Then, 1 µg of pX330 plasmid (Addgene) was digested with 1 U/µL of FastDigest BbsI (Thermo Scientific) restriction enzyme at 37 °C for 30 min in the presence of 1 U/µL Fast alkaline phosphatase (Thermo Scientific). The digested plasmid was agarose gel purified (QIAquick Gel extraction kit, Qiagen). Further, each pair of oligos (100 pmol) were phosphorylated and annealed in presence of 500 U/µL of T4 polynucleotide kinase at 37 °C for 30 min and 95 °C for 5 min and then ramped down to 25 °C at 5 °C/min to form oligo duplexes. This was followed by a ligation reaction with digested pX330 plasmid, oligo duplex (1:250) and quick ligase (New England Biolabs) along with 2X quick ligation buffer for 10 min at RT. The ligated CRISPR cas9 construct along with RCP specific sequence was transformed in a competent bacteria DH5alpha (NEB).

Phatak V., von Grabowiecki Y., Janus J., Officer L., Behan C., Aschauer L., Pinon L., Mackay H., Zanivan S., Norman J.C., Kelly M., Le Quesne J, & Muller P.A. (2021). Mutant p53 promotes RCP-dependent chemoresistance coinciding with increased delivery of P-glycoprotein to the plasma membrane. Cell Death & Disease, 12(2), 207.

+ Open protocol

+ Expand

CRISPR-Cas9 Plasmid Validation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tesmin-specific guide sequences (sgRNAs) were designed and inserted into the pX330 plasmid (#42230, Addgene, Cambridge, MA, USA). Validation of DNA cleavage activity of these plasmids was performed as described previously [15 , 16 (link)].

Oji A., Isotani A., Fujihara Y., Castaneda J.M., Oura S, & Ikawa M. (2020). Tesmin, Metallothionein-Like 5, is Required for Spermatogenesis in Mice. Biology of Reproduction, 102(4), 975-983.

+ Open protocol

+ Expand

Inactivation of Myrlysin Gene Using CRISPR/Cas9

Check if the same lab product or an alternative is used in the 5 most similar protocols

We inactivated the myrlysin gene using the CRISPR/Cas9 system (Cong et al., 2013 (link)). Briefly, two 20-base pair (bp) targeting sequences (GCTCAACAG CATGCTGCCCG and AGCAGATCCAGAAAGTGAAC) were synthesized (Eurofins) and introduced separately into the px330 plasmid (Addgene). HeLa cells were co-transfected with both plasmids and re-seeded after 72 hr to allow single colony formation. After 12 days, genomic DNA was extracted from individual colonies, and cleavage of the target sequence was tested by PCR using a pair of primers (ATCTGCGGGACTGTGTCCCT and CAGATTTTCAT GCCAGCCGG), which produced a 99-bp smaller band in KO cells relative to WT cells. The KO was confirmed by Sanger sequencing and immunoblotting.
To generate myrlysin-GFP-rescued cells and proper control cells, retrovirus particles were prepared by transfecting HEK293T cells with the pQCXIP-myrlysin-GFP or pQCXIP-GFP plasmid and retrovirus packaging plasmids (Clontech Laboratories). Stably transduced cells were selected with 2 μg/ml puromycin.

Pu J., Schindler C., Jia R., Jarnik M., Backlund P, & Bonifacino J.S. (2015). BORC, a Multisubunit Complex that Regulates Lysosome Positioning. Developmental cell, 33(2), 176-188.

+ Open protocol

+ Expand

Genetically Engineered H2AX-EGFP 293T Cell Line

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The H2AX-EGFP 293T cell line was first generated using the previously reported MMEJ-mediated CRIS-PITCh system [36 (link),37 (link)]. Briefly, we cloned two gRNAs (Supplementary Table S3) that respectively target H2AX gene and the PITCh vector into the px330 plasmid (Addgene, #42230). The PITCh vector contains a pair of 20-bp homologous sequences targeting the upstream and downstream regions of the H2AX gRNA cleavage site, and the SFB-EGFP expression cassette. The three plasmids were co-transfected into 293T cells at an equimolar ratio. GFP-positive cells were sorted by FACS and individually expanded to isolate single clones for genomic DNA extraction and PCR verification of successful knock-in (KI) of the SFB-EGFP cassette into 5′-end of first exon of the H2AX gene. The selected H2AX-EGFP 293T cell clone was subsequently infected with lentiviruses encoding tetracycline-inducible SpCas9 (iCas9). After drug selection, individual clones were again expanded and verified for inducible Cas9 expression. The selected clone was subsequently infected with lentivirus encoding a gRNA that targets EGFP. Puromycin-resistant clones (1 μg/μL, Thermo Fisher Scientific) were then isolated after >7 days for further analysis.

Yang Y., Li D., Wan F., Chen B., Wu G., Li F., Ren Y., Liang P., Wan J, & Songyang Z. (2022). Identification and Analysis of Small Molecule Inhibitors of CRISPR-Cas9 in Human Cells. Cells, 11(22), 3574.

+ Open protocol

+ Expand

CRISPR-Cas9 Genome Editing with Donor Vector

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

A pair of oligonucleotides against Lcn9 sgRNA (5’-TTGCTTTTTATAGACCATAGAGG-3’) were annealed and cloned into the pX330 plasmid (42230; Addgene) through BbsI site. Cas9 mRNA and sgRNA were synthesized with a mMESSAGE mMACHINE T7 transcription kit (AM1344; Life Technologies) and MEGAshortscript T7 transcription kit (AM1354; Life Technologies), respectively.
For donor vector construction, 2A self-cleaving peptides-nuclear localization signal -Cre (2A-NLS-Cre) sequence, 1.0 kb 5’-homology arm, the 970 bp 3’-homology arm, and other DNA fragments were pooled together and assembled by a “T5 exonuclease DNA assembly” method [31 (link)]. The donor vector was digested by KpnI and EcoRI. Linearized DNA fragments were recovered and purified.

Gong Q.Q., Wang X., Dou Z.L., Zhang K.Y., Liu X.G., Gao J.G, & Sun X.Y. (2021). A novel mouse line with epididymal initial segment-specific expression of Cre recombinase driven by the endogenous Lcn9 promoter. PLoS ONE, 16(7), e0254802.

+ Open protocol

+ Expand

Dox-inducible Cas9 Flp-in Vector

Check if the same lab product or an alternative is used in the 5 most similar protocols

A prototype of Dox‐inducible Cas9 Flp‐in vector containing the IRES‐mCherry cassette for KH2 ESC was described previously.12 The Rosa26‐tetOP‐(“Gateway att” site)‐IRES‐mCherry targeting vector was described previously.13Cas9 ORF was cloned from pX330 plasmid (#42230; Addgene, Watertown, MA, USA). To reduce background expression of Cas9, tetOP was replaced with tetracycline response element, third generation (TRE3G, from pTRE3G; Clontech, Mountain View, CA, USA). MultiSite Gateway Cloning Site (MGCS)9 was cloned upstream of TRE3G by In‐Fusion cloning (Clontech).

Jo N., Sogabe Y., Yamada Y., Ukai T., Kagawa H., Mitsunaga K., Woltjen K, & Yamada Y. (2019). Platforms of in vivo genome editing with inducible Cas9 for advanced cancer modeling. Cancer Science, 110(3), 926-938.

+ Open protocol

+ Expand

CRISPR-Cas9 Editing of Lef1 and Cygb

Check if the same lab product or an alternative is used in the 5 most similar protocols

Two guide RNAs (gRNA1 and gRNA2) used for editing Lef1 and Cygb were constructed using CRISPR design software.28 The sequences of gRNA1 and gRNA2 used for targeting Lef1 are 5′‐TTGTTGTACAGGCCTCCGTC‐3′ and 5′‐GTACGGGTCGCTGTTCATAT‐3′, respectively. The sequences of gRNA1 and gRNA2 used for targeting Cygb are 5′‐GAAGGCGGTTCAGGCTACGT‐3′ and 5′‐TGAAGTACTGCTTGGCCGAA‐3′, respectively. The Lef1 and Cygb gRNAs were inserted into a unique BbsI site of the pX330 plasmid (42230; Addgene, Cambridge, MA, USA). We used a fluorescence indicator system using the pCAG/EGxxFP plasmid29 provided by Dr Ikawa (Osaka University, Osaka, Japan) to select cells whose genomes were correctly edited using the CRISPR‐Cas9 system. GFP‐positive colonies were selected, and 2 independent LM8‐H/Lef1‐KO and LM8‐H/Cygb‐KO clones each were established from the gRNA1‐ and gRNA2‐mediated KO cells.

Pongsuchart M., Kuchimaru T., Yonezawa S., Tran D.T., Kha N.T., Hoang N.T., Kadonosono T, & Kizaka‐Kondoh S. (2018). Novel lymphoid enhancer‐binding factor 1‐cytoglobin axis promotes extravasation of osteosarcoma cells into the lungs. Cancer Science, 109(9), 2746-2756.

+ Open protocol

+ Expand

Optimized CRISPR Targeting of mEnh-Sox2distal

Check if the same lab product or an alternative is used in the 5 most similar protocols

Target-specific CRISPR guide RNAs were designed to optimize uniqueness and have limited off-targets using an online tool (http://crispr.mit.edu/). Corresponding oligonucleotides were ordered (IDT) and subcloned into the pX330 plasmid (Addgene), expressing a human codon-optimized SpCas9 and chimeric guide RNA expression plasmid, following previously published guidelines [20] (link). The sequences flanking mEnh-Sox2^distal targeted by the CRISPR constructs are:
5′-CRISPR: GACGCTTCCGTTCTTGGAGTAGG3′-CRISPR: TTGGATTCCCGACAACAAGCTGG

Li Y., Rivera C.M., Ishii H., Jin F., Selvaraj S., Lee A.Y., Dixon J.R, & Ren B. (2014). CRISPR Reveals a Distal Super-Enhancer Required for Sox2 Expression in Mouse Embryonic Stem Cells. PLoS ONE, 9(12), e114485.

+ Open protocol

+ Expand

CRISPR-Cas9 Targeting of Porcine PCBP1

Check if the same lab product or an alternative is used in the 5 most similar protocols

CrRNA sequence was searched through the porcine PCBP1 gene using the CHOPCHOP webtools (https://chopchop.cbu.uib.no/). CACC sequence was added at 5′ end of the top strand of selected crRNA sequences and AAAC was added at 5′ end of the bottom strand. These sgRNA oligonucleotides were synthesized by Comate Bioscience CO., LTD and ligated into linear pX330 plasmid (42230, Addgene) digested by Bbs I to form the intact targeting plasmids. The pHA-PCBP1-His plasmid was generated by cloning PCBP1 CDS sequence flanked by HA and His tag into pcDNA3.1 (+). The plasmids used in this research were confirmed by DNA sequencing.

Qi C., Pang D., Yang K., Jiao S., Wu H., Zhao C., Hu L., Li F., Zhou J., Yang L., Lv D., Tang X., Ouyang H, & Xie Z. (2022). Generation of PCBP1-deficient pigs using CRISPR/Cas9-mediated gene editing. iScience, 25(10), 105268.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!