β catenin sirna

Manufactured by Santa Cruz Biotechnology

Sourced in United States, China

β-catenin siRNA is a laboratory product that targets the β-catenin gene. It is designed to reduce the expression of the β-catenin protein in experimental cell models.

Automatically generated - may contain errors

Lab products found in correlation

Control sirna, by Santa Cruz Biotechnology (3 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (3 mentions) Scramble sirna, by RiboBio (1 mentions) Pcdna6 v5 his, by Thermo Fisher Scientific (1 mentions) Lipo2000, by Thermo Fisher Scientific (1 mentions) Sc 29209, by Santa Cruz Biotechnology (1 mentions) Xav939, by Merck Group (1 mentions) Non phospho active β catenin, by Cell Signaling Technology (1 mentions) Recombinant human transforming growth factor beta 1 tgf β1, by R&D Systems (1 mentions) Phospho erk1 2, by Cell Signaling Technology (1 mentions) U0126, by Cell Signaling Technology (1 mentions) Erk1 2, by Cell Signaling Technology (1 mentions) Anti phospho gsk3β, by Cell Signaling Technology (1 mentions) Anti β catenin, by Cell Signaling Technology (1 mentions) Anti gsk3β, by Cell Signaling Technology (1 mentions) Mcp 1 sirna, by Santa Cruz Biotechnology (1 mentions) Ne per nuclear and cytoplasmic extraction kit, by Thermo Fisher Scientific (1 mentions) Matrigel invasion chamber, by BD (1 mentions) Mtt assay kit, by Roche (1 mentions) Neon transfection system, by Thermo Fisher Scientific (1 mentions)

11 protocols using β catenin sirna

Transfection and Knockdown in HeLa Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were transfected with Lipofectamine 3000 (Invitrogen, L3000015, Carlsbad, CA, USA). The stably transfected HeLa cells were obtained as previously described [21 (link)].
The knockdown cell lines were transiently transfected with two different siRNA, which target MAGI3 and HPV18E6, and the sequences obtained as described previously [21 (link), 24 (link)] were synthesized by Sangon Biotech (Shanghai, China) Co., Ltd. The siRNA targeting β‐catenin was purchased from Santa Cruz (sc‐29209), and the siRNA sequences obtained were as follows: β‐catenin siRNA#1: 5′‐GAUAAAGGCUACUGUUGGAUU‐3′; β‐catenin siRNA#2: 5′‐CCACUAAUGUCCAGCGUUUUU‐3′.

Yang Z., Liu H., Song R., Lu W., Wang H., Gu S., Cao X., Chen Y., Liang J., Qin Q., Yang X., Feng D, & He J. (2021). Reduced MAGI3 level by HPV18E6 contributes to Wnt/β‐catenin signaling activation and cervical cancer progression. FEBS Open Bio, 11(11), 3051-3062.

+ Open protocol

+ Expand

Modulating β-catenin in H460 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Constitutively active β-catenin plasmid was from Addgene and β-catenin siRNA was from Santa Cruz Bio Technology. H460 cells (2 × 10⁵/well) in a six-well plate were transfected with the indicated plasmids (0.1 μg/ml) or siRNAs (50 nM) by Lipofectamine 3000™ following the manufacturer's instructions (Invitrogen). After 48 h, cells were harvested for the tumorsphere formation assay or western blots.

Liu S., Guo Y., Wang J., Zhu H., Han Y., Jin M., Wang J., Zhou C., Ma J., Lin Q., Wang Z., Meng K, & Fu X. (2016). A novel anticancer agent SNG1153 inhibits growth of lung cancer stem/progenitor cells. Oncotarget, 7(29), 45158-45170.

+ Open protocol

+ Expand

Modulating Osteogenic Differentiation of BMMSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

BMMSCs were seeded on twelve‐well culture dishes and grown to 80%–90% confluence followed by serum starvation for 2h. Ca_v1.2 (Santa Cruz Biotechnology, sc‐42689) or β‐catenin siRNA (Santa Cruz Biotechnology, sc‐29210) was transfected into BMMSCs at a final concentration of 50 nM, and overexpression plasmid of Ca_v1.2 (addgene, Plasmid #26572) was transfected into BMMSCs at 500 ng. For the control groups of siRNA or plasmid transfection experiments, scramble siRNA (RiboBio) or control overexpression vector pcDNA6/V5‐His (Invitrogen) was included. Lipo2000 (Invitrogen) was used as a transfection reagent according to the manufacturer's instructions. After transfection, the culture medium was substituted by normal culture medium and cells were harvested at 48 hr for RNA and 72 hr for protein extraction. For detection of the osteogenic differentiation capacity, transfection medium was removed in the next day and replaced by osteogenic induction medium.

Fei D., Zhang Y., Wu J., Zhang H., Liu A., He X., Wang J., Li B., Wang Q, & Jin Y. (2019). Cav1.2 regulates osteogenesis of bone marrow‐derived mesenchymal stem cells via canonical Wnt pathway in age‐related osteoporosis. Aging Cell, 18(4), e12967.

+ Open protocol

+ Expand

TGF-β1 Signaling Pathway Inhibition

Check if the same lab product or an alternative is used in the 5 most similar protocols

NaHS (Sodium hydrosulfide) was purchased from Sigma (USA). To prepare stock solution, NaHS is dissolved in PBS (135 mM NaCl, 2.7 mM KCL, 1.5 mM KH₂PO4, 8 mM Na₂HPO4) to the concentration of 1M. Recombinant Human transforming growth factor beta 1 (TGF-β1) is purchased from R&D Systems (USA). The inhibitor U0126 is purchased from Cell Signaling Technology and reconstituted with DMSO to 10 mM stock solution according to the product instruction. The inhibitor XAV939 is purchased from Sigma and reconstituted with DMSO to 10 mM stock solution according to the product instruction.
The primary antibodies to phospho-ERK1/2, ERK1/2, phospho-Catenin and Non-phospho (Active) β-Catenin were purchased from Cell Signaling Technology (USA). The primary antibodies to α-SMA and E-cadherin were purchased from Epitomics (USA). The primary antibodies to TGF-β receptor I, CBS and GAPDH were purchased from Santa Cruz Biotechnology (CA, USA). Antibody to Fibronectin was purchased from Sigma (USA). The secondary AlexaFluor488-conjugated anti-rabbit antibody for Immunofluorescent staining was purchased from Invitrogen. BCA Protein Assay Kit was purchased from Shanghai Biocolor BioScience & Technology Company (Shanghai, China). β-catenin siRNA and control siRNA were purchased from Santa Cruz Biotechnology (CA, USA).

Guo L., Peng W., Tao J., Lan Z., Hei H., Tian L., Pan W., Wang L, & Zhang X. (2016). Hydrogen Sulfide Inhibits Transforming Growth Factor-β1-Induced EMT via Wnt/Catenin Pathway. PLoS ONE, 11(1), e0147018.

+ Open protocol

+ Expand

Silencing Snail1 and β-catenin in RPTEC

Check if the same lab product or an alternative is used in the 5 most similar protocols

To silence Snail1 and β-catenin genes in RPTEC, a stable transfection assay was conducted with 3 µg Snail1 siRNA and β-catenin siRNA (Santa Cruz Biotechnology) injected into the cells by using a commercial lipofectamine 3000 mixture (Life Technologies, Grand Island, NY). The Snail1 siRNA- or β-catenin siRNA-lipofectamine 3000 mixture was incubated with RPTEC for 24 h at 37°C. After the transfection, cells were treated with high glucose for 72 h in the absence and presence of 20 μM eucalyptol. Cells were lysed in a lysis buffer and Western blot analysis was conducted with anti-human Snail1, anti-human E-cadherin, anti-human GSK-3β and anti-human β-catenin.

Kim D.Y., Kang M.K., Park S.H., Lee E.J., Kim Y.H., Oh H., Choi Y.J, & Kang Y.H. (2017). Eucalyptol ameliorates Snail1/β-catenin-dependent diabetic disjunction of renal tubular epithelial cells and tubulointerstitial fibrosis. Oncotarget, 8(63), 106190-106205.

+ Open protocol

+ Expand

Invasion Assay Procedure for Cell Migration

Check if the same lab product or an alternative is used in the 5 most similar protocols

MTT assay kit was purchased from Roche Molecular Biochemicals (Indianapolis, IN). Transwells were purchased from Becton Dickinson Labware (Franklin lakes, NJ). Matrigel Invasion Chambers were purchased from BD Biosciences (Bedford, MA). Alcohol (200 Proof) was obtained from Fisher Scientific (Pittsburgh, PA). MCP-1 Human ELISA Kit was purchased from Invitrogen Corporation (Carlsbad, CA). Anti-human MCP-1 antibody and CCR2 antagonist (CCR2-I) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Recombinant Human MCP-1/CCL2 was purchased from Biolegend (San Diego, CA). Anti-β-catenin, anti-non phospho β-catenin (Ser33/37/Thr41), anti-phospho-GSK3β and anti-GSK3β antibodies were purchased from Cell Signaling Technology Inc. (Beverly, MA). β-catenin siRNA, MCP-1 siRNA and CCR2 siRNA were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-Ref-1 antibody was provided by Dr. Xianglin Shi (University of Kentucky, Lexington, KY). NE-PER Nuclear and Cytoplasmic Extraction Kit was purchased from Thermo Scientific (Rockford, IL). All other chemicals were obtained from Sigma-Aldrich (St. Louis, MO).

Xu M., Wang S., Qi Y., Chen L., Frank J.A., Yang X.H., Zhang Z., Shi X, & Luo J. (2015). Role of MCP-1 in Alcohol-induced Aggressiveness of Colorectal Cancer Cells. Molecular carcinogenesis, 55(5), 1002-1011.

+ Open protocol

+ Expand

Exploring Wnt11 and β-Catenin Roles in Adipogenesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

MPCs were grown in culture in EBM2/20% FBS until confluent. On the day of transfection, cells were trypsinized and re-suspended with control or β-catenin siRNA (30 nM final concentration; Santa Cruz Biotechnologies, Santa Cruz, CA, sc-29209) and subjected to electroporation (1400v, 20 ms, 2 pulses) using Neon Transfection System (Life Technologies). For simultaneous knockdown of Wnt11 and β-catenin, cells were trypsizined and re-suspended in a mixture of both siRNA sets (30 nM each; Wnt11 siRNA sc-41120, Santa Cruz Biotechnologies) and transfected as before. Knockdown efficiency was determined at day 7 in normal growth media or adipogenesis media by real time RT-PCR and ELISA. GFP-RhoA Expression Vector Set (contains dominant negative and wild type; STA-452, Cell BioLabs, San Diego, CA), or GFP-Rac1 Expression Vector Set (contains dominant negative and wild type; STA-450, Cell BioLabs) were also used at 1 µg using the same electroporation protocol as for siRNA. Transfected cells were transferred to a 24-well plate containing EBM2 media without antibiotics. The following day the media was changed to adipogenic media (StemPro® Adipogenesis Differentiation media) with or without the addition of HG.

Keats E.C., Dominguez JM 2.n.d., Grant M.B, & Khan Z.A. (2014). Switch from canonical to noncanonical Wnt signaling mediates high glucose-induced adipogenesis. Stem cells (Dayton, Ohio), 32(6), 1649-1660.

+ Open protocol

+ Expand

Knockdown of β-Catenin and E-Cadherin

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cell lines were plated in six-well plates with fresh media without antibiotics for 24 h before transfection. Cells were transfected with β-catenin siRNA (sc-29209, Santa Cruz Biotechnology, Santa Cruz, CA, USA), E-cadherin siRNA (sc-35242, Santa Cruz) and control siRNA (sc-37007, Santa Cruz Biotechnology), using Lipofectamine-2000 (Invitrogen) according to the manufacturer's instruction. All the siRNAs were composed of a pool of two target-specific 19–25 nt siRNAs, The cells were harvested at 48 hours post-transfection.

Miao Y., Wang L., Zhang X., Xu X., Jiang G., Fan C., Liu Y., Lin X., Yu J., Zhang Y, & Wang E. (2014). Promoter Methylation-Mediated Silencing of β-Catenin Enhances Invasiveness of Non-Small Cell Lung Cancer and Predicts Adverse Prognosis. PLoS ONE, 9(11), e112258.

+ Open protocol

+ Expand

Modulating β-catenin in Lung Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

β-catenin siRNA and control siRNA were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). pcDNA-β-catenin and control vector were purchased from Addgene (Cambridge, MA, USA). A549 and H1299 cells were cultured in 6-well plates at a density of 10⁵ cells in PRMI1640 medium. After incubation for 12 h, the cells were transiently transfected with pcDNA-β-catenin (2 μg), control vector (2 μg), or β-catenin siRNA (50 nM), and control siRNA (50 nM), using lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. After transfection for 4–6 h, cells were collected and plated in SFM for another 3 days with or without apatinib.

Zhu J., Li X., Liang C., Zhou X., Ge M., Chen Y., Jin J., Yin J., Xu H., Xie C, & Zhong C. (2021). Apatinib suppresses lung cancer stem-like cells by complex interplay between β-catenin signaling and mitochondrial ROS accumulation. Cell Death Discovery, 7, 102.

+ Open protocol

+ Expand

Alcohol-Induced Hepatocellular Carcinoma

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Salinomycin and GSK-3 inhibitor SB-216763 were ordered from Sigma. β-catenin siRNA was ordered from Santa Cruz. Alcohol-induced HCC cells were treated with 0.2% v/v alcohol as our previous study [47 (link)].

Chen D., Yan Y., Wang X., Li S., Liu Y., Yu D., He Y., Deng R., Liu Y., Xu M., Luo J., Gao H, & Wang S. (2021). Chronic alcohol exposure promotes HCC stemness and metastasis through β-catenin/miR-22-3p/TET2 axis. Aging (Albany NY), 13(10), 14433-14455.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!