Qiazole

Cell lysates were harvested using 400 μLQiazole (Qiagen), and total RNA was extracted according to the manufacturer’s protocol (Zymo Research). Library was prepared and sequenced by Illumina Hiseq. 3000 at the UCLA Technology Center for Genomics and Bioinformatics. Single-end transcriptome reads were mapped to the Ensemble GRCh37 reference genome using Tophat2. HTSeq-count was used to count the reads for each gene^{58 (link)}. EdgeR was then utilized to normalizeand identify differentially expressed genes based on negative binomial distribution. A gene was defined as differentially expressed between two conditions if i) its Benjamini and Hochberg based false discovery rate was less than 0.05, and ii) its fold change was more than 2. Average log-ratio expressions of identified differential expressed genes were then subjected to hierarchical cluster analysis by utilizing Cluster 3.0 with metric based on cosine similarity and average linkage in clustering approach. The sequencing data is accessible at GEO (GSE142620).

mRNA isolation was performed using QIAzole (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The purity and concentration of RNA were evaluated using an Epoch reader and Gen 5.2 reader (BioTek, Winooski, Vermont, VT, USA). A Prime Script II First-Strand cDNA Synthesis Kit (TaKaRa, Otsu, Japan) was used to synthesize cDNA. Subsequently, RT-PCR was performed using the ABI StepOnePlus Real-Time PCR system (Applied Biosystems, Foster City, CA, USA). The RT-PCR reaction mixture contained the following: primers (Table 1), cDNA, and SYBR Premix Ex Taq (TaKaRa). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), a housekeeping gene, was used to normalize the mRNA expression data. Gene expression was compared using the 2^−ΔΔCT method [54 (link)]. The data were obtained from experiments biologically repeated two times.
Table 1

Primer sequences used for real-time quantitative PCR

Target gene	Primer sequence (5′-3′)		Product length (bp)	Accession number
	Forward (Tm)	Reverse (Tm)
Nestin SOX2 GFAP MBP β3-tubulin	TTCCAACCCTTCTCTCGGCT (59.7) AACCCCAAGATGCACAACTC (58.3) CTGCGGCTAGACCAACTCAC (60.7) GCAGATGTGGAGCAGAACAA (58.4) AGCACGGTATAGACCCCAGT (59.0)	CAAGGGTATCAGGCAAGGGC (60.1) CGGGGCCGGTATTTATAATC (55.8) CCAGATCCAGACGGGCTAAG (59.6) GTCCTCTTGGATGGTCTGGA (58.4) TCCGTGTAGTGACCTTTGGC (58.6)	137 152 187 225 244	XM_025430810.2 XM_038445642.1 XM_038676213.1 XM_038653864.1 XM_038666722.1

Prior to total RNA isolation, equal volume of plasma (500 µL) or 500 uL of 10 mL concentrated culture supernatant samples were thawed on ice, mixed with QIAzole (Qiagen), vortexed and incubated at RT for 5 mins. Synthetic C. elegans (cel)-miR-39 was spiked and after this step total RNA was extracted using Zymo research Direct-zol RNA MiniPrepKit as per instructions. TaqMan miRNA Assay (Applied Biosystems) was used to analyze the miRNA from serum or plasma samples. Cel-miR-39 was used to normalize the technical variation between the exosomes samples and when comparing miRNA or HCV RNA content in cell lines compared to exosomes. Quantification of miR-122 was performed using Taqman microRNA assays (Applied Biosystems). RNU48 was used as an endogenous control for miR-122 expression in cells and Cel-miR-39 was used as an exogenous control to normalize for technical variation in RNA isolation for determining miR-122 levels in exosomes.

mRNA was isolated from MSCs-GFP and MSCs-GFP-HS using QIAzole (Qiagen, Hilden, Germany) solution according to the manufacturer’s protocol. RNA purity and concentration were determined using Gen 5.2 reader type, Epoch (BioTek, Winooski, Vermont, VT, USA). cDNA was synthesized using the Prime Script II First-Strand cDNA Synthesis Kit (TaKaRa, Otsu, Japan). RT-qPCR was performed using the ABI StepOnePlus Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) by mixing SYBR Premix Ex Taq (TaKaRa) and the specified primers (Table 1). The mRNA expression was normalized with GAPDH and quantification for comparison of gene expression was performed using the 2^−ΔΔCT method [22 (link)].