Invitrogen qubit 3.0 spectrophotometer

Specific forward (5′‐TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGG GNGGCWGCAG‐3′) and reverse (5′‐GTCTCGTGGGCTCGGAGATGTGTATAAGA GACAGGACTACHVGGGTATCTAATCC‐3′) primers targeting 16S rDNA gene V3–V4 variable regions were used for the amplification of the genomic DNA template. The amplicon was sequenced at Genesky Biotechnologies Inc., and three repeated experiments were set for each sample. Total DNA was purified and separated by use of Agencourt AMPure XP magnetic beads (Beckman Coulter). After an original library was formed by the addition of sample‐specific index sequences, it was quantified and pooled with the Invitrogen Qubit 3.0 Spectrophotometer (Thermo Fisher Scientific) and checked with the Agilent 2100 bioanalyzer (Agilent Technologies). The libraries were constructed by 2 × 250‐bp paired‐end sequencing on the Illumina MiSeq platform.

Microbial cells were collected by filtering 23 L surface seawater (≤5 m) from each station through a 0.2-μm pore-size Isopore membrane filter (142-mm diameter, Merck Millipore, USA) with a peristaltic pump. The filters were kept at −80°C prior to extraction of DNA.
To extract the total genomic DNA, we used the DNeasy PowerWater kit (Qiagen, Germany) and followed the manufacturer’s instructions. To evaluate DNA quality and purity, we used both gel electrophoresis and a NanoDrop 2000 analyzer (Thermo Fisher Scientific, USA). An Invitrogen Qubit 3.0 Spectrophotometer (Thermo Fisher Scientific, USA) was used to accurately measure the DNA concentrations. The hypervariable V3-V4 region of the bacterial 16S rRNA gene was amplified with a forward primer 341F (CCTACGGGNGGCWGCAG) and a reverse primer 805R (GACTACHVGGGTATCTAATCC) (35 (link)); the hypervariable V4 of the eukaryotic 18S rRNA gene was amplified with a forward primer TAReuk454FWD1 (CCAGCASCYGCGGTAATTCC) and a reverse primer TAReukREV3 (ACTTTCGTTCTTGATYRA) (36 (link)). For each sample, 25-cycle polymerase chain reactions (PCRs) were applied in triplicate. The PCR products were checked via gel electrophoresis and further purified with a commercial kit (Agencourt AMpure XP PCR Purification Beads, Beckman Coulter, USA). Paired-end sequencing was applied with an Illumina Miseq Benchtop Sequencer system.