Seqscape v2

Manufactured by Thermo Fisher Scientific

Sourced in United States, France, Germany

SeqScape v2.5 is a software application for DNA sequence analysis. It provides tools for viewing, editing, and comparing DNA sequence data.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

SeqScape software v2.5 (56 citations) SeqScape (37 citations) ABI SeqScape Software v2.5 (2 citations)

93 protocols using seqscape v2

Comprehensive DNA Extraction and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

We used the DNA Wizard Genomic DNA Purification Kit and the ReliaPrep gDNA Tissue Miniprep System (Promega Corporation, Madison, WI, USA) for DNA extraction and purification, with the standard protocol for animal tissue. Polymerase chain reaction (PCR) amplification of nuclear 18S rDNA, D1 region of 28S rDNA and Histone 3, and mitochondrial 16S rDNA gene fragments was accomplished with the primers and conditions described by Radashevsky et al. [124 (link), 125 (link)]. We used primers 5' GGTCAACAAATCATAAAGATATTGG 3' and 5' TAAACTTCAGGGTGACCAAAAAATCA 3' to amplify the mitochondrial gene fragment of cytochrome C oxidase subunit 1 (COI) [126 (link)]. Cycling parameters were as follows: initial denaturation at 94°C for 2 min, 35 cycles of 94°C for 30 s, 50°C for 40 s, 72°C for 60 s, with a final extension of 72°C for 5 min.
Purified PCR products were bidirectionally sequenced on an ABI Prism 3100 Genetic Analyzer (Applied Biosystems) using the BigDye Terminator v 3.1 Cycle Sequencing Kit (Applied Biosystems) and the same primers as for PCR. The consensus sequence of each gene region of each specimen was assembled from the two complementary sequences using SeqScape v 2.5 (Applied Biosystems). GenBank accession numbers of the obtained sequences are given in Table 1.

Radashevsky V.I., Pankova V.V., Malyar V.V., Neretina T.V., Choi J.W., Yum S, & Houbin C. (2020). Molecular analysis of Spiophanes bombyx complex (Annelida: Spionidae) with description of a new species. PLoS ONE, 15(7), e0234238.

+ Open protocol

+ Expand

Bisulfite Conversion of DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Bisulfite conversion of DNA was performed using the EZ DNA Methylation kit and the Human Methylated and Non‐Methylated DNA Set (Zymo Research, Freiburg, Germany), followed by Sanger sequencing and analysis in SeqScape v2.5 (Applied Biosystems).

Coppieters F., Todeschini A.L., Fujimaki T., Baert A., De Bruyne M., Van Cauwenbergh C., Verdin H., Bauwens M., Ongenaert M., Kondo M., Meire F., Murakami A., Veitia R.A., Leroy B.P, & De Baere E. (2015). Hidden Genetic Variation in LCA9‐Associated Congenital Blindness Explained by 5′UTR Mutations and Copy‐Number Variations of NMNAT1. Human Mutation, 36(12), 1188-1196.

+ Open protocol

+ Expand

Targeted Genomic Sequencing of EGFR and KRAS

Check if the same lab product or an alternative is used in the 5 most similar protocols

EGFR exons 19 and 20 and KRAS exons 2 and 3 were amplified by PCR (for primer pairs see S1 Table). Amplified products were then purified using Exostar 1-Step (VWR International) according to the manufacturer's instructions. Sequencing reactions were performed using the Big Dye Terminator version 3.1 (Applied Biosystems, Foster City, CA, USA). Dye purification was carried out by Centrisep Spin columns (Princeton Separation) and subsequent sequencing analysis was resolved on a 3130XL Genetic Analyzer (Applied Biosystems). Sequences were finally analyzed with Sequence Analysis v5.2 and SeqScape v2.5 (Applied Biosystems).

Presutti D., Santini S., Cardinali B., Papoff G., Lalli C., Samperna S., Fustaino V., Giannini G, & Ruberti G. (2015). MET Gene Amplification and MET Receptor Activation Are Not Sufficient to Predict Efficacy of Combined MET and EGFR Inhibitors in EGFR TKI-Resistant NSCLC Cells. PLoS ONE, 10(11), e0143333.

+ Open protocol

+ Expand

Mutational Analysis of Hic1, Inpp5k, and Myo1c

Check if the same lab product or an alternative is used in the 5 most similar protocols

A panel of 32 EC tumors was selected for mutation sequencing of Hic1 and Myo1c (Additional file 1: Table S1). The Inpp5k gene was sequenced in 18 tumors. Primer pairs were designed using the Primer3 program and synthesized by a commercial supplier (SIGMA-Genosystem, Cambridge, UK). PCR primers set corresponding to the coding sequences of Hic1, Inpp5k and Myo1c genes were amplified and screened for mutations (Additional file 3: Table S2). For the Myo1c gene the promoter region was also sequenced.
PCR amplification products were purified using GFX™ PCR DNA and gel Band Purification Kit (Amersham Pharmcia Biotech, Piscataway, NJ). Using ABI PRISM® BigDye® Terminator v1.1 or 3.1 Cycle Sequencing Kit (Applied Biosystems), the purified DNA fragment were subjected to sequencing according to the protocol provided by the manufacturer. Sequencing products were separated on a denaturing polyacrylamide gel on a 3130xl Genetic Analyzer (Applied Biosystems) and analyzed using the software’s Sequencing Analysis v5.2 and SeqScape v2.5 (Applied Biosystems).

Hedberg Oldfors C., Dios D.G., Linder A., Visuttijai K., Samuelson E., Karlsson S., Nilsson S, & Behboudi A. (2015). Analysis of an independent tumor suppressor locus telomeric to Tp53 suggested Inpp5k and Myo1c as novel tumor suppressor gene candidates in this region. BMC Genetics, 16, 80.

+ Open protocol

+ Expand

Amplification and Sequencing of HBV Genome

Check if the same lab product or an alternative is used in the 5 most similar protocols

The preS1/preS2/S region of HBV was amplified from each sample by PCR using primers F8 and R9 (Table 1) while for samples with low viral load, a second round of amplification with nested primer pair F3 and R8 was performed. Similarly, amplification of basal core promoter (BCP) and Precore (PC) region of HBV was carried out with primer pairs F7-R2 and F1-SP2 (Table 1) in single or two-step nested PCR reactions as appropriate. From selected samples full length HBV DNA was amplified with primers P1 and P2 (Table 1). In case of low HBV DNA level, a second round nested PCR was subsequently performed using two different primer sets, MP1 with R5 and F3 with MP2 [1] (link). All PCR products were purified by the QIA quick Gel Extraction Kit (Qiagen, CA) and the nucleotide sequences were determined using BigDye terminator cycle sequencing kit (AB Applied Biosystems, Foster City, CA) on automated DNA sequencer (ABI Prism 3130). DNA sequence editing and analysis were performed using Seqscape V2.5 (Applied Biosystems) software.

Banerjee P., Mondal R.K., Nandi M., Ghosh S., Khatun M., Chakraborty N., Bhattacharya S., RoyChoudhury A., Banerjee S., Santra A., Sil S., Chowdhury A., Bhaumik P, & Datta S. (2014). A Rare HBV Subgenotype D4 with Unique Genomic Signatures Identified in North-Eastern India –An Emerging Clinical Challenge?. PLoS ONE, 9(10), e109425.

+ Open protocol

+ Expand

TP53 Mutation Profiling in Colorectal Cancer

Cited 3 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

MSI analysis was performed as previously described.15 (link)TP53 mutation status was assessed in all 401 samples by sequencing the entire coding region (exons 2–11), as well as the first ten and last 10 nucleotides of each intron. Sequencing was done by Sanger sequencing technology using BigDye Terminator V.1.1 Cycle Sequencing Kit (Applied Biosystems) according to the manufacturer’s procedure. The samples were run on the 3730 DNA Analyzer (Applied Biosystems). All electropherograms were scored manually and independently by two of the authors, assisted by the SeqScape V.2.5 and Sequencing Analysis V.5.3.1 software (both Applied Biosystems). All mutations were resequenced for validation. Splice mutations were defined as any mutation affecting any of the first or the last 10 nucleotides of an intron, based on the finding that intron mutations outside the invariant AG and GT dinucleotides in the consensus splice acceptor and splice donor site, respectively, may lead to mis-splicing.24 (link) Tumours harbouring only synonymous mutations were classified as TP53 wild type (wt) in survival analysis. Mutation analyses had previously been performed for KRAS (exon 2: codons 12 and 13)14 (link) and BRAF (codon 600)25 (link) in all 401 samples. KRAS exon 3 codon 61 was analysed in a subset of samples (n=127).

Smeby J., Sveen A., Bergsland C.H., Eilertsen I.A., Danielsen S.A., Eide P.W., Hektoen M., Guren M.G., Nesbakken A., Bruun J, & Lothe R.A. (2019). Exploratory analyses of consensus molecular subtype-dependent associations of TP53 mutations with immunomodulation and prognosis in colorectal cancer. ESMO Open, 4(3), e000523.

+ Open protocol

+ Expand

Phylogenetic Analysis of SARS-CoV-2 Variants

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Briefly, HA gene sequencing was done in a subset of positive samples using an ABI 3730 DNA analyzer as described earlier (16 (link), 18 (link)). Sequences were curated by Seqscape V2.5 software (Applied Biosystems, United States). Pairwise sequence alignment and phylogeny of the HA gene were performed using best fit Tamura-Nei nucleotide substitution model to generate a neighbor-joining tree. The MEGA 6 program (19 (link)) was used to generate multiple sequence alignment and phylogenetic trees. SARS-CoV-2 positive samples were referred to INSACOG laboratories for sequencing. The trends of prevailing variants of SARS-CoV-2 at different time points in India can be accessed on the Indian SARS-CoV-2 Genomics Consortium (INSACOG) dashboard (20 ).

Potdar V., Vijay N., Mukhopadhyay L., Aggarwal N., Bhardwaj S.D., Choudhary M.L., Gupta N., Kaur H., Narayan J., Kumar P., Singh H., Abdulkader R.S., Murhekar M., Mishra M., Thangavel S., Nagamani K., Dhodapkar R., Fomda B.A., Varshney U., Majumdar A., Dutta S., Vijayachari P., Turuk J., Majumdar T., Sahoo G.C., Pandey K., Bhargava A., Negi S.S., Khatri P.K., Kalawat U., Biswas D., Khandelwal N., Borkakoty B., Manjushree S., Singh M.P., Iravane J., Kaveri K., Shantala G.B., Brijwal M., Choudhary A., Dar L., Malhotra B, & Jain A. (2023). Pan-India influenza-like illness (ILI) and Severe acute respiratory infection (SARI) surveillance: epidemiological, clinical and genomic analysis. Frontiers in Public Health, 11, 1218292.

+ Open protocol

+ Expand

MHC I Haplotyping of Bovine Samples

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Sequence based MHC I haplotyping of non-BNP and BNP dams was performed as described by Benedictus et al.12 (link). In short, gene-specific primers aligning with intron 1 and intron 3 of putative MHC I genes 1,2,3 and 646 (link) are used to amplify exons 2 and 3 encoding the most polymorphic region of the MHC I. PCR products were sequenced and SeqScape© (v2.5, Applied Biosystems) was used to match consensus sequences to a library of exon 2 and 3 sequences of all known MHC I alleles documented on the IPD MHC database (http://www.ebi.ac.uk/ipd/mhc/bola/). MHC I haplotypes were determined using haplotypes defined in Codner et al.15 (link) and Benedictus et al.12 (link).

Benedictus L., Luteijn R.D., Otten H., Jan Lebbink R., van Kooten P.J., Wiertz E.J., Rutten V.P, & Koets A.P. (2015). Pathogenicity of Bovine Neonatal Pancytopenia-associated vaccine-induced alloantibodies correlates with Major Histocompatibility Complex class I expression. Scientific Reports, 5, 12748.

+ Open protocol

+ Expand

Genotyping of NOL6 and CDC45 variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

AC_000165.1:g.76542321C>T in NOL6 was amplified using the following primers: forward primer 5′-AGAGCTGAGGCGGATCATAG-3′ and reverse primer 5′-AGGGGTTTGTGGTCCAGTTT-3′, and the PCR products were digested with BsrGI (NEB, Cat. #R0575S). The resulting fragments were separated by electrophoresis on 1.5% agarose gels using 100 bp ladder markers (NEB, Cat. #N3231L). AC_000174.1:g.74743512G > T in CDC45 was genotyped by direct sequencing of the PCR products using the following primers: forward primer 5′-TGGACAAGCTGTACCACGG-3′ and reverse primer 5′-GAGCACACGAAGGACTTGAG-3′. The PCR products were amplified with using Ex Taq DNA Polymerase (Takara, Cat. #RR006), sequenced using the BigDye Terminator v.3.1 Cycle Sequencing Kit (Applied Biosystems), separated by electrophoresis using the ABI 3730 sequencer (Applied Biosystems), and genotyped using SeqScape V2.5 (Applied Biosystems).

Sasaki S., Watanabe T., Ibi T., Hasegawa K., Sakamoto Y., Moriwaki S., Kurogi K., Ogino A., Yasumori T., Wakaguri H., Muraki E., Miki Y., Yoshida Y., Inoue Y., Tabuchi I., Iwao K., Arishima T., Kawashima K., Watanabe M., Sugano S., Sugimoto Y, & Suzuki Y. (2021). Identification of deleterious recessive haplotypes and candidate deleterious recessive mutations in Japanese Black cattle. Scientific Reports, 11, 6687.

+ Open protocol

+ Expand

Targeted MSH2 Gene Mutation Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

We looked for mutations in parts of the MSH2 gene where the most predominant mutations were found (according to reference 27 (link)). The primers used in this study were as follows: MSH2Fragment2, 5′-TCACGTGGATTCAGCAGTT-3′, and MSH2Fragment2, 5′-TCGTTGCCTAATAGTTTTGCC-3′; MSH2Fragment3, 5′-TCGGTGGTTACCATAGTCCCTA-3′, and MSH2Fragment3, 5′-TCTGGGACCTTCAAAACTAAACTG-3′. The PCR mixture conditions and sequencing were the same as those described above. Sequence alignments were analyzed using SeqScape v2.5 (Applied Biosystems) and compared with the C. glabrata genome database sequences (GenBank accession number CR380955).

Prigent G., Aït-Ammar N., Levesque E., Fekkar A., Costa J.M., El Anbassi S., Foulet F., Duvoux C., Merle J.C., Dannaoui E, & Botterel F. (2017). Echinocandin Resistance in Candida Species Isolates from Liver Transplant Recipients. Antimicrobial Agents and Chemotherapy, 61(2), e01229-16.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!