Synaptophysin

Manufactured by Agilent Technologies

Sourced in United States, Denmark

Synaptophysin is a protein found in the synaptic vesicles of presynaptic neurons. It is commonly used as a marker in immunohistochemistry and Western blotting applications to identify the presence and distribution of synaptic terminals.

Automatically generated - may contain errors

Lab products found in correlation

24 protocols using synaptophysin

Immunohistochemical Analysis of Neuronal Markers

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Immunohistochemistry was performed as previously described [30 (link)]. Paraffin sections were deparaffinized, dehydrated, and heated in Histofine Simple Stain MAX PO (MULTI) (Nichirei, Japan) for 20 min. After washing with distilled water, samples were placed in 1% hydrogen peroxide/methanol for 15 min to block endogenous peroxidase. Then, samples were incubated with blocking buffer (Protein Block Serum Free solution, DAKO) for 10 min at room temperature, the sections were then incubated at room temperature for 60 min in primary antibodies diluted with antibody diluent (Dako). The following primary antibodies against the antigens were used: Tuj-1 (1:300, Promega), Synaptophysin (1:400, DAKO), Nestin (1:200, Sigma-Aldrich), Ki-67 (1:100, Abcam), p53 (DAKO, 1:50). Then, they were washed three times with 0.01 M Tris buffered saline (TBS) solution (pH 7.4) and incubated with goat anti-mouse or anti-rabbit immunoglobulin labeled with dextran molecules and horseradish peroxidase (EnVision, Dako) at room temperature for 30 min. After washing with TBS, they were incubated in 3,3’-diaminobenzidin in substrate-chromogen solution (Dako) for 5-10 min. Negative controls were performed by omitting the primary antibody. The sections were counterstained with hematoxylin.

Ikemoto Y., Miyashita T., Nasu M., Hatsuse H., Kajiwara K., Fujii K., Motojima T., Kokido I., Toyoda M, & Umezawa A. (2020). Gorlin syndrome-induced pluripotent stem cells form medulloblastoma with loss of heterozygosity in PTCH1. Aging (Albany NY), 12(10), 9935-9947.

+ Open protocol

+ Expand

Histological Analysis of Spinal Cords

Check if the same lab product or an alternative is used in the 5 most similar protocols

Spinal cords were harvested from 13‐month‐old WT and Sirt2^−/− mice, after perfusion with PFA 4%, basically as described (Morato et al., 2015). Spinal cords were embedded in paraffin, and serial sections (5 μm thick) were cut in a transversal or longitudinal (1‐cm‐long) plane. The number of abnormal specific profiles was counted at every 10 sections for each stain. At least three sections corresponding to the dorsal columns of the spinal cord were analyzed per animal and per stain. The sections were stained with hematoxylin and eosin and Sudan black, or processed for immunohistochemistry using glial fibrillary acidic protein (GFAP) [Dako, rabbit polyclonal, 1:500, Santa Clara, California, USA], synaptophysin [Dako, monoclonal, 1:500, Santa Clara, California, USA], CD68 [Abcam, rabbit polyclonal, 1:500, Cambridge, Massachusetts, USA], and RT97 [Boehringer, rabbit polyclonal, 1:500]; and with Iba‐1 [Wako, rabbit polyclonal, 1:1000] used as a marker of microglial cells. The results were expressed as the mean ± standard deviation.

Fourcade S., Morató L., Parameswaran J., Ruiz M., Ruiz‐Cortés T., Jové M., Naudí A., Martínez‐Redondo P., Dierssen M., Ferrer I., Villarroya F., Pamplona R., Vaquero A., Portero‐Otín M, & Pujol A. (2017). Loss of SIRT2 leads to axonal degeneration and locomotor disability associated with redox and energy imbalance. Aging Cell, 16(6), 1404-1413.

+ Open protocol

+ Expand

Histopathological and Immunohistochemical Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The excised tumor tissues were routinely processed. The sections were stained with hematoxylin and eosin (H&E) for routine histopathological evaluation. Immunohistochemical examinations were also conducted on representative sections using indirect immunoperoxidase technique with antibodies to NSE (1:100; Dako USA), GFAP (1:50; BioGenex USA), Synaptophysin (1:50; Dako USA), NeuN (1:50; BioGenex USA), S-100 (1:100; BioGenex USA), NF (1:1000; BioGenex USA), MAP-2 (1:1000; Sternberger Monoclonals USA) and MIB-1 (1:50; Dako USA).

Xu N., Cai J., Du J., Yang R., Zhu H., Gao P., Zhou J, & Li X. (2017). Clinical features and prognosis for intraventricular liponeurocytoma. Oncotarget, 8(37), 62641-62647.

+ Open protocol

+ Expand

Enriching mtDNA from Neuronal Synaptosomes

Check if the same lab product or an alternative is used in the 5 most similar protocols

In an effort to enrich for mtDNA from neurons, we isolated synaptosomes from 100–200 mg of tissue of each case using a previously established protocol.^{9 (link)} Purity of the resulting synaptosome fraction was evaluated by western blot analysis using antibodies against GFAP (DAKO) and synaptophysin (DAKO) (Fig 1D). DNA was extracted from the synaptosome pellet using the QIAamp DNA Micro kit, following instructions for tissue isolation. The relative purity of each mtDNA prep was determined by qPCR using the following primers sets: Nuclear Primers FR: 5’GGGCACTGATCTACACAGTAAG3’ RR: 5’TAGTAAGCGCTCAGCAAAGG3’ Mitochondrial Primers FR: 5’CCTCAACAGTTAAATCAACAA3’ RR: 5’GCGCTTACTTTGTAGCCTTCA3’

Hoekstra J.G., Hipp M.J., Montine T.J, & Kennedy S.R. (2016). Mitochondrial DNA Mutations Increase in Early Stage Alzheimer’s Disease and are Inconsistent with Oxidative Damage. Annals of neurology, 80(2), 301-306.

+ Open protocol

+ Expand

Protein Expression Profiling in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cell Signaling (Beverly, MA) antibodies: EGF receptor variant III (EGFRvIII) (Cat# 64952), p-Akt (S473; Cat# 4060), p-NDRG1 (T346; Cat# 5482), Rictor (Cat# 2114), 5-methylcytosine (5-mC) (Cat# 28692), DNMT3A (Cat #3598), acetylated-lysine (Cat# 9441), H3 p.K27me2 (Cat# 9755), H3 p.K27me3 (Cat# 9733), Histone H3 (Cat# 4499), EZH2 (Cat# 5246), FAK (Cat# 13009), p-FAK (Y397; Cat# 8556), β-actin (Cat# 3700), GAPDH (Cat# 5174), HRP-linked anti-rabbit IgG (Cat# 7074) and HRP-linked anti-mouse IgG (Cat# 7076). Santa Cruz (Dallas, TX) antibodies: p-PKC α (S657; Cat# sc-377565). GeneTex (Irvine, CA) antibodies: 5-mC (Cat# GT4111). Thermo Fisher antibodies: GRIA1 (Cat# PA5-95207). DAKO (Glostrup, Denmark) antibodies: Synaptophysin (Cat# M731529). Millipore (Burlington, MA) antibodies: Nestin (Cat# MAB5326).
Reagents used are sodium acetate (Sigma; Cat # S5636), Trichostatin A (TSA) (Sigma; Cat# T1952), PP242 (Cayman Chemical, Ann Arbor, MI; Cat# 13643), Akti-1/2 (Calbiochem, La Jolla, CA; Cat# 124018), Bisindolylmaleimide I (Bis-I) (Santa Cruz; Cat# sc-24003), GSK 650394 (Tocris Bioscience, Bristol, UK; Cat# 3572/10), GSKJ4 (Sigma; Cat# T1952), GSK126 (MedChem Express, Monmouth Junction, NJ; Cat# HY-13470), GSK2256098 (Selleck Biotech, Kanagawa, Japan; Cat# S8523) and Philanthotoxin-7,4 (PhTx-74) (Abcam, Cambridge, UK; Cat# ab120257).

Harachi M., Masui K., Shimizu E., Murakami K., Onizuka H., Muragaki Y., Kawamata T., Nakayama H., Miyata M., Komori T., Cavenee W.K., Mischel P.S., Kurata A, & Shibata N. (2024). DNA hypomethylator phenotype reprograms glutamatergic network in receptor tyrosine kinase gene-mutated glioblastoma. Acta Neuropathologica Communications, 12, 40.

+ Open protocol

+ Expand

Hippocampal Protein Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

After the MWM test, the pups were sacrificed by decapitation and their brains were rapidly removed, weighed and frozen. Protein extracts from the hippocampus were separated with SDS-PAGE and electro-transferred to a nitrocellulose membrane. The membranes were blocked with 5% nonfat dry milk in tris-buffered saline and incubated first with primary antibodies that recognize PSD95 (1:2000, Abcam), synaptophysin (1:1000, Dako) and insulin receptor (1:500 Santa Cruz Biotechnology, San Diego, CA, USA) overnight at 4°C, and then with their corresponding secondary HRP-conjugated antibodies. Protein signal was detected using the ECL chemiluminescent system (Amersham, Buckinghamshire, UK) (Fig 1C).

Duran Fernandez-Feijoo C., Carrasco Carrasco C., Villalmazo Francisco N., Cebrià Romero J., Fernández Lorenzo J.R., Jiménez-Chillaron J.C, & Camprubí Camprubí M. (2017). Influence of catch up growth on spatial learning and memory in a mouse model of intrauterine growth restriction. PLoS ONE, 12(5), e0177468.

+ Open protocol

+ Expand

Comprehensive Immunohistochemical Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

HE staining: All specimens were fixed by 10% neutral formalin, regularly dehydrated, paraffin-embedded, sectioned into 3-μm sections, and processed for HE staining. IHC staining: IHC staining was performed using the EnVision two-step strategy. Primary antibody information: CD117, HMB45, Desmin, synaptophysin, chromograninA, S100 protein, wide-spectrum cytokeratin, Ki67, and vimentin (DAKO); Bcl2, P53, CD56, CD57 (LEICA); muscle specific actin (MSA), CD34, H-caldesmon (LongIsland); SOX10, INI1, DOG-1 (Gene Tech); somatostatin receptor 2 (SSTR2), somatostatin receptor 5 (SSTR5) (Abcam); α-smooth muscle actin (α-SMA) (Thermo); ATRX (Sigma); calponin, Collagen type IV (MXB Biotechnologies); BRAF V600E (ZSGB Biotechnology). The dilutions, clone and sources of these antibodies were listed in Table 1.

Deng M., Luo R., Huang J., Luo Y., Song Q., Liang H., Xu C., Yuan W, & Hou Y. (2023). Clinicopathologic features of gastric glomus tumor: A report of 15 cases and literature review. Pathology and Oncology Research, 28, 1610824.

+ Open protocol

+ Expand

Biochemical Analysis of Brain Regions

Check if the same lab product or an alternative is used in the 5 most similar protocols

Brain and peripheral organs were dissected for further biochemical and/or pathological analysis. The right prefrontal cortex, entorhinal cortex, and hippocampus were dissected out, weighed, snap-frozen separately, and stored at –80 °C until processing for preparation of protein extract for biochemistry analysis. Frozen samples were lysed in cold lysis buffer containing protease and phosphatase inhibitors (Sigma-Aldrich, Saint Louis, MO, USA). Protein content was quantified with the BCA Protein Assay Kit (Thermo Fisher Scientific, Waltham, MA, USA), resolved on SDS-polyacrylamide gel electrophoresis, and detected by Western blotting using the following antibodies: 6E10 (1:500, Biolegend, San Diego, CA, USA); synaptophysin (1:2000, Dako, Glostrup, Denmark); ChAT (1:500, Thermo Fisher Scientific, Waltham, MA, USA), β-actin (1:10,000; Sigma-Aldrich, Saint Louis, MO, USA). Bands were detected with an enhanced chemiluminescent reagent in a ChemiDoc MP System (Bio-Rad Laboratories, Inc., Hercules, CA, USA) and quantified in a linear range using the ImageLab 5.2.1 software (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

Muntsant A, & Giménez-Llort L. (2021). Genotype Load Modulates Amyloid Burden and Anxiety-Like Patterns in Male 3xTg-AD Survivors despite Similar Neuro-Immunoendocrine, Synaptic and Cognitive Impairments. Biomedicines, 9(7), 715.

+ Open protocol

+ Expand

Immunohistochemical Staining Validation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ten well-characterized antibodies [AE1/AE3, BCL2, CD20, CD3, CD68, cytokeratin 7, E-cadherin, Ki-67, MSH2, and synaptophysin (Dako, Carpinteria, CA)] were selected to represent a range of nuclear, cytoplasmic, and membrane staining patterns in a variety of tissues (Table 1). All antibodies were in the ready-to-use formulation, and all other Dako reagents [heat-induced epitope retrieval solutions, buffers, labeled polymer, 3,3′-diaminobenzidine (DAB) and hematoxylin counterstain] were designed for use with the Dako Omnis Autostainer. The same antibody solutions were used across all 12 staining runs at 2 locations, and all staining runs were performed within 21 days. All reagents for all staining runs were from single lots.

Chlipala E.A., Bendzinski C.M., Dorner C., Sartan R., Copeland K., Pearce R., Doherty F, & Bolon B. (2019). An Image Analysis Solution For Quantification and Determination of Immunohistochemistry Staining Reproducibility. Applied Immunohistochemistry & Molecular Morphology, 28(6), 428-436.

+ Open protocol

+ Expand

Immunohistochemical Characterization of Tumor Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

Standard ABC peroxidase techniques were used for immunohistochemistry performed on 4 μ sections of formalin-fixed and paraffin-embedded tissue. Antigen retrieval in heated citrate buffer at pH 6.0 was applied for all antibodies. The Ki67 monoclonal-antibody (1:100), Rb monoclonal-antibody (1:400), p53 monoclonal-antibody (1:500), Chromogranin-A polyclonal-antibody (1:8000), and synaptophysin (1:500) were obtained from Dako (Carpentaria, CA). The SMAD4 monoclonal-antibody (1:800) was acquired from Santa Cruz Bio (Santa Cruz, CA). The ATRX polyclonal-antibody (1:500) and DAXX (1:100) polyclonal-antibody were obtained from Sigma-Aldrich Corporation (St. Louis, MO). Immunohistochemistry was performed on BenchMark XT automated equipment (Ventana Medical System Inc., Tucson, AZ). Positive control tissue was stained in parallel with each study case. The Ki67 immunoreactivity was expressed as the percentage of tumor cells with nuclear staining, which was based upon digital counting >2,000 tumor cells in regions with the highest labeling recognizable on scanning magnification. p53 immunoreactivity with strong staining intensity in >25% tumor cells was regarded as abnormal (positive), and complete loss of SMAD4, DAXX, ATRX, and Rb protein expression (negative), in the presence of positive staining in non-neoplastic cells, was regarded as abnormal.

Tang L.H., Basturk O., Sue J.J, & Klimstra D.S. (2016). A Practical Approach to the Classification of WHO Grade 3 (G3) Well Differentiated Neuroendocrine Tumor (WD-NET) and Poorly Differentiated Neuroendocrine Carcinoma (PD-NEC) of the Pancreas. The American journal of surgical pathology, 40(9), 1192-1202.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!