One clonal line of patient iPSCs was treated overnight with 5 uM ROCK inhibitor (Ri) (Tocris), then dissociated to single cells with Accutase (StemPro, ThermoFisher), and passed through a 40 μm nylon mesh (BD Biosciences) to ensure single cells prior to transfection. Using Human Stem Cell Nucleofector Kit 2 and Amaxa program B16 (Lonza), 2 × 106 cells were nucleofected with 9 mg of the CMV::Cas9-2A-EGFP vector or CMV::Cas9D10A-2A-EGFP (gifts from Kiran Musunuru; Addgene, #44719 and #44720) and 3 μg of the U6::gRNA vector. Transfected cells were plated in mTeSR supplemented with 5 μM Ri for 48 hr before FACS. GFP-expressing cells were selected using the BD influx at the UCSD Human Embryonic Stem Cell Core Facility. Isolated colonies were selected, expanded, and genomic DNA was extracted (DNeasy kit, QIAGEN) for PCR and sequencing analysis. All clones were initially screened by PCR using the PCRx enhancer system (Invitrogen, Life Technologies). Several clonal lines were further investigated by TOPOcloning (ThermoFisher) the PCR product, selecting 10 resulting bacterial clones, isolating DNA (QIAprep kit, QIAGEN), and sequencing (Eton Bioscience; San Diego, CA). One resulting clonal line was selected for further studies.
Pcrx enhancer system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The PCRx enhancer system is a laboratory equipment designed to improve the efficiency and performance of polymerase chain reaction (PCR) experiments. It is a solution-based additive that can be used to enhance the amplification of target DNA sequences during PCR.
Automatically generated - may contain errors
Lab products found in correlation
Nylon mesh, by BD (2 mentions)
Rock inhibitor, by Bio-Techne (2 mentions)
Dneasy kit, by Qiagen (2 mentions)
Qiaprep kit, by Qiagen (2 mentions)
Amaxa program b16, by Lonza (2 mentions)
Human stem cell nucleofector kit 2, by Lonza (2 mentions)
Taq dna polymerase, by Thermo Fisher Scientific (1 mentions)
Pcr buffer, by Thermo Fisher Scientific (1 mentions)
Mgso4, by Thermo Fisher Scientific (1 mentions)
Platinum taq dna polymerase, by Thermo Fisher Scientific (1 mentions)
Mutation surveyor software, by SoftGenetics (1 mentions)
Miseq system, by Illumina (1 mentions)
Truemethyl oxbs module, by Tecan (1 mentions)
6 protocols using pcrx enhancer system
1
CRISPR/Cas9-mediated Gene Editing in iPSCs
2
CRISPR/Cas9-mediated Gene Editing in iPSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
One clonal line of patient iPSCs was treated overnight with 5 uM ROCK inhibitor (Ri) (Tocris), then dissociated to single cells with Accutase (StemPro, ThermoFisher), and passed through a 40 μm nylon mesh (BD Biosciences) to ensure single cells prior to transfection. Using Human Stem Cell Nucleofector Kit 2 and Amaxa program B16 (Lonza), 2 × 106 cells were nucleofected with 9 mg of the CMV::Cas9-2A-EGFP vector or CMV::Cas9D10A-2A-EGFP (gifts from Kiran Musunuru; Addgene, #44719 and #44720) and 3 μg of the U6::gRNA vector. Transfected cells were plated in mTeSR supplemented with 5 μM Ri for 48 hr before FACS. GFP-expressing cells were selected using the BD influx at the UCSD Human Embryonic Stem Cell Core Facility. Isolated colonies were selected, expanded, and genomic DNA was extracted (DNeasy kit, QIAGEN) for PCR and sequencing analysis. All clones were initially screened by PCR using the PCRx enhancer system (Invitrogen, Life Technologies). Several clonal lines were further investigated by TOPOcloning (ThermoFisher) the PCR product, selecting 10 resulting bacterial clones, isolating DNA (QIAprep kit, QIAGEN), and sequencing (Eton Bioscience; San Diego, CA). One resulting clonal line was selected for further studies.
3
Equine Herpesvirus-1 ORF68 Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR primers were designed to amplify ORF68 (US2) (detailed in Table 5 ) based on EHV-1 reference sequences Ab4 (GenBank accession AY665713.1) and V592 (GenBank accession AY464052.1) using the online application Primer3 [72 (link)]. Amplification was performed using the G-Storm (Gene Technologies) with the PCRx Enhancer System (catalogue no. 11495-017, Invitrogen) which is specific for the amplification of problematic and/or GC-rich templates. The reaction component consisted of 1X PCRx Amplification Buffer, 1.5 mM MgSO4, 2X PCRx Enhancer Solution, 0.4 µM each primer, 5 U of Taq DNA Polymerase (5 U/µL, Invitrogen), 0.2 mM dNTP Mixture (Applied Biosystems), 10 µL of template DNA, and nuclease free water to a final volume of 50 µL. Initial denaturation was carried out at 95 °C for 5 min, followed by amplification with 40 cycles of 95 °C for 30 s, 50 °C for 1 min, 72 °C for 2 min, and a final elongation at 72 °C for 10 min.
4
Genetic Analysis of FBN1 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from EDTA-anticoagulated whole blood. All 65 exons of FBN1 and a minimum of 20 basepairs (bp) of intronic DNA flanking each exon were amplified by PCR. Amplification was performed using a common master mix containing Platinum Taq DNA Polymerase, 10 × PCRx Enhancer System, 10 × PCR Buffer (-MgCl), MgSO 4 (all from Invitrogen, Carlsbad, CA, USA), and a 10 mM dNTP mixture (Roche, Indianapolis, IN, USA). Master mix, forward and reverse primers were combined with genomic DNA and amplified by 35 cycles of PCR (30 s at 95 °C; 30 s initially at 68 °C then decreased by 0.5 °C each cycle, with the last 20 cycles performed at 60 °C; and 1 min extension at 72 °C, with a final 10 min extension at 72 °C). Amplicons were bi-directionally sequenced using Big Dye Terminator technology on an ABI 3730 system (Applied Biosystems, Foster City, CA, USA). Sequence analysis was done using the Mutation Surveyor software (Soft-Genetics, State College, PA, USA) and visual inspection.
5
Validating PTEN promoter hydroxymethylation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Validation of hydroxymethylation at the PTEN promoter was performed in an independent sample group (four nevi and four melanoma metastases). Genomic DNA (1 μg) was subjected to BS and OxBS conversion using TrueMethyl oxBS Module (NuGEN Technologies, Redwood City, CA, USA). DNA was amplified using the PCRX Enhancer System (Thermo Fisher Scientific, Waltham, MA, USA) and subjected to capillary sequenced (primers: GGGGTTGTAAATAGATTTGATAGG and AAAAATATCTCCTACTACAACCCAAAA) and deep paired‐end sequencing (tailed primers: GATGTGTATAAGAGACAGGGGGTTGTAAATAGATTTGATAGG and CGTGTGCTCTTCCGATCTAAAAATATCTCCTACTACAACCCAAAA) using a MiSeq system (Illumina).
6
TERT Promoter Mutation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The presence of the C228T and C250T TERTp mutations in some samples was evaluated by conventional Sanger sequencing. DNA samples were amplified through the PCRX Enhancer System (Thermo Fisher Scientific) using primers (Sigma-Aldrich) and amplification program described by McEvoy et al. [25 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!