Q5 2 master mix

Manufactured by New England Biolabs

Sourced in United States

Q5 2× Master Mix is a ready-to-use solution for high-fidelity DNA amplification. It contains the Q5 High-Fidelity DNA Polymerase, dNTPs, and reaction buffer optimized for efficient and accurate DNA synthesis.

Automatically generated - may contain errors

Lab products found in correlation

E coli dh5α, by New England Biolabs (1 mentions) Qiaprep kit, by Qiagen (1 mentions) Wizard genomic dna preparation kit, by Promega (1 mentions) Agarose e gel, by Thermo Fisher Scientific (1 mentions) Nebuilder hifi dna assembly cloning kit, by New England Biolabs (1 mentions) Dpni fastdigest enzyme, by Thermo Fisher Scientific (1 mentions) Stellar competent cells, by Takara Bio (1 mentions) In fusion hd cloning kit, by Takara Bio (1 mentions)

Close spelling variants of this product

Q5 master mix

7 protocols using q5 2 master mix

Yeast and E. coli Genetic Manipulation

Check if the same lab product or an alternative is used in the 5 most similar protocols

S. cerevisiae CEN.PK113–7D (MATa URA3 TRP1 LEU2 HIS3 MAL2–8c SUC2) was the host strain for all library constructs and grown at 30 °C in yeast extract–peptone–dextrose media, with 200 μg/mL G418 added when appropriate. Yeast transformations were carried out according to the lithium acetate method (35 , 36 (link)). Chemically competent E. coli DH5α (New England Biolabs) was used as a cloning strain and grown at 37 °C in lysogeny broth media with appropriate antibiotics (100 μg/mL carbenicillin or 25 μg/mL kanamycin) and inducer (100 μL of 40 mg/mL 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside) was spread and dried on plates for blue/white screening when appropriate.
All Sanger sequencing reactions were performed by Quintara Biosciences. Plasmid isolations were performed with Qiagen Qiaprep kits. Genomic DNA was isolated using the Promega Wizard Genomic DNA Preparation Kit. Gel electrophoresis was carried out using 1% agarose E-Gels according to the manufacturer’s instructions (Invitrogen). BsaI was purchased from New England Biolabs. BbsI was purchased from Thermo Fisher Scientific. High concentration T4 DNA ligase was purchased from Promega. All PCR primers were ordered from Integrated DNA Technologies. All PCRs used Q5 2× Master Mix from New England Biolabs. PCRs were performed on Eppendorf thermocyclers.

Burén S., Pratt K., Jiang X., Guo Y., Jimenez-Vicente E., Echavarri-Erasun C., Dean D.R., Saaem I., Gordon D.B., Voigt C.A, & Rubio L.M. (2019). Biosynthesis of the nitrogenase active-site cofactor precursor NifB-co in Saccharomyces cerevisiae. Proceedings of the National Academy of Sciences of the United States of America, 116(50), 25078-25086.

+ Open protocol

+ Expand

Site-directed Homologous Recombination for Strain Generation

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Δvp1 and Δrgg strains were generated by site-directed homologous recombination where the target region was replaced with the spectinomycin-resistance gene (aadR) (Al-Bayati et al., 2017 (link); Eutsey et al., 2015 (link)). The spectinomycin-resistance gene was inserted on the complementary strand, to decrease the likelihood of polar effects. The Δvp1:vp1 complemented strain was generated by inserting the vp1 gene fused to the kanamycin resistance cassette into the spectinomycin cassette of the Δvp1 strain. Briefly, approximately 2kb of flanking region upstream and downstream of the deletion target were amplified from the parental strain by PCR using Q5 2× Master Mix (New England Biolabs, USA) generating flanking regions, and the spectinomycin resistant gene was amplified from the plasmid pR412 (kindly provided by Dr. Donald Morrison). Assembly of the transforming cassette was achieved by either sticky-end ligation of restriction enzyme-cut PCR products or by Gibson Assembly using NEBuilder HiFi DNA Assembly Cloning Kit. The resulting constructs were transformed into PN4595-T23 and confirmed using PCR and DNA sequencing. Primers used to generate the constructs are listed in Table S5.

Cuevas R.A., Eutsey R., Kadam A., West-Roberts J.A., Woolford C.A., Mitchell A.P., Mason K.M, & Hiller N.L. (2017). A novel streptococcal cell-cell communication peptide promotes pneumococcal virulence and biofilm formation. Molecular microbiology, 105(4), 554-571.

+ Open protocol

+ Expand

Constructing Mutant Strains via Homologous Recombination

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mutant strains were constructed by using site-directed homologous recombination and selected by the addition of an antibiotic resistance marker. The term⁺ transformation construct was generated by ligating the amplified flanking regions with antibiotic resistance cassette followed by transcriptional terminator B1002. Between 1 to 2 kb of flanking regions upstream and downstream of the region of interest were amplified from parental strain using Q5 2× master mix (New England Biolabs, USA). The antibiotic resistance gene ermB and its promoter were amplified from S. pneumoniae SV35-T23. The sequence of the terminator was added to the primers. The PCR products were assembled by Gibson assembly using NEBuilder HiFi DNA assembly cloning kit (New England Biolabs, USA). The promoter, ermB, and terminator were inserted downstream of accA decoupling the transcription of briC from FASII locus.

Aggarwal S.D., Gullett J.M., Fedder T., Safi J.P., Rock C.O, & Hiller N.L. (2021). Competence-Associated Peptide BriC Alters Fatty Acid Biosynthesis in Streptococcus pneumoniae. mSphere, 6(3), e00145-21.

+ Open protocol

+ Expand

Cloning using Q5 Master Mix

Check if the same lab product or an alternative is used in the 5 most similar protocols

Oligos were ordered from IDT. All cloning was performed with Q5 2 × master mix (NEB) unless otherwise noted. Primers and plasmids used or generated in this study can be found in Data S6.

Waldman B.S., Schwarz D., Wadsworth MH I.I., Saeij J.P., Shalek A.K, & Lourido S. (2020). Identification of a Master Regulator of Differentiation in Toxoplasma. Cell, 180(2), 359-372.e16.

+ Open protocol

+ Expand

Engineered CHIKV-GFP Mutants

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Using the IVA cloning approach [46 (link)], we simultaneously introduced two mutations (nsP2 S259P and R650D) into the CHIKV-GFP. Briefly, mutagenic primers were designed according to the IVA protocol, synthesized by Integrated DNA Technologies (IDT), and then used for mutagenic PCR with Q5 2× Master Mix (New England Biolabs #M0492S) instead of the Phusion polymerase. Following DpnI digestion (Thermo Fisher Scientific #FD1703) to remove residual wild-type plasmid, the PCR was transformed into Turbo competent cells (New England Biolabs #C2984I) and incubated at 30°C overnight. The following day, individual colonies were grown in 2× YT media and mini-preps were subsequently performed (Macherey Nagel #740588). The presence of mutations was confirmed using Sanger sequencing.

Boussier J., Levi L., Weger-Lucarelli J., Poirier E.Z., Vignuzzi M, & Albert M.L. (2020). Chikungunya virus superinfection exclusion is mediated by a block in viral replication and does not rely on non-structural protein 2. PLoS ONE, 15(11), e0241592.

+ Open protocol

+ Expand

Generation of Pld4 Knockout Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

B6.Pld4^−/− and B6.Pld4^mut/mut strains were generated in a CRISPR/Cas9 targeting experiment using B6 zygotes. The guide RNA sequences used were 5′-GTGTTCTACACTCCAAATTC-3′ and 5′-ACTCCAAATTCTGGGTTG-3′. The targeting construct was an oligonucleotide (purchased from IDT) of the following sequence: 5′-A*A*TGACCCCCACAAGATCCTAGGCTTAAGACCCAAC*A*C-3′, in which the asterisks indicate phosphorothioate linkages, and the underlined bases are modified from wild type (WT) to alter codons encoding HSK amino acid residues in the first HKD motif to GSE and generating a new BamHI site. Mice with modified alleles were identified from ear punch DNA preparations using a PCR with the following primers: mPLD4-KI-test-F2, 5′-AGATCTATTAGGCAGTTCTGAAGTTA-3′, and mPLD4-KI-test-R1, 5′-GGTCATGTAGAACCTTCTAACTGGT-3′. After an initial denaturation at 94°C for 5 min, PCR conditions were 94°C for 30 s, 57°C for 30 s, and 72°C for 25 s for 40 cycles using the Q5 2× mastermix (NEB). The PCR products (414 bp) were then digested at bp 143 with BamH1 to identify the knock-in. A second digest with ApoI cuts adjacent to the target site in both WT and knock-in, but not in the knockout, allele D14, which has deleted 14 bp, including the HSK codons and ApoI site in the targeted exon.

Gavin A.L., Blane T.R., Thinnes T.C., Gerlt E., Marshak-Rothstein A., Huang D, & Nemazee D. (2023). Disease in the Pld4thss/thss Model of Murine Lupus Requires TLR9. ImmunoHorizons, 7(8), 577-586.

+ Open protocol

+ Expand

Cloning CHIKV Coding Sequence into Inducible Expression Vector

Check if the same lab product or an alternative is used in the 5 most similar protocols

Primers were designed to have a melting temperature around 60°C and synthesized from Integrated DNA Technologies. The vector used was pLVX-TRE3G-mCherry (Takara #631349) and the CHIKV coding sequence came from an IOL La Réunion strain infectious clone [45 (link)]. 50 μL PCR using Q5 2× Master Mix (New England Biolabs #M0492S) were performed using 20 or 100 ng of DNA template for the insert or the vector, respectively, and a final concentration of 0.25 μM of each primer, according to the following protocol: 30 s at 95°C, 18 cycles of 10 s at 95°C, 30 s at 65°C, 4.5 min at 72°C, and a final 5 min extension at 72°C. In each sample, 1 μL of FastDigest DpnI enzyme (Thermo Fisher Scientific #FD1703) was added, and they were incubated 2 h at 37°C prior to purification on columns (Macherey Nagel #740609). Inserts were cloned into the vector with In-Fusion HD cloning kit (Takara #638920) following manufacturer's instructions, and 2.5 μL of the reaction was transformed into 50 μL of Stellar Competent Cells (Takara #636766). The following day, individual colonies were grown in 2× YT media and mini-preps were subsequently performed (Macherey Nagel #740588). The presence of the insert was confirmed using Sanger sequencing.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!