In order to prepare total RNA using the PeqGOLD total RNA kit (#732–2871, Peqlab/VWR Life Science, Bruchsal, Germany), 1 × 105 cells were seeded per well of a 6-well plate and treated as described in the figure legends. Subsequently, cDNA was synthesized with the qScript Flex cDNA Kit (#95049, Quantabio, Beverly, MA, USA) and used as template for qRT-PCR using the PerfeCTa SYBR Green SuperMix (#95049, Quantabio) and the CFX96 Touch Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA). Relative gene expression levels were calculated by normalizing transcript levels of the genes under investigation to those of GAPDH, using the 2−ΔCt method.
Qscript flex cdna kit
Manufactured by Quantabio
Sourced in United States
The QScript Flex cDNA kit is a reverse transcription reagent system designed for the conversion of RNA to complementary DNA (cDNA). The kit includes components necessary for first-strand cDNA synthesis, including a reverse transcriptase enzyme, random primers, and buffer solutions.
Automatically generated - may contain errors
Lab products found in correlation
Sybr green master mix, by Thermo Fisher Scientific (3 mentions)
Perfecta sybr green fastmix, by Quantabio (2 mentions)
Steponeplus, by Thermo Fisher Scientific (2 mentions)
Perfecta sybr green supermix, by Quantabio (1 mentions)
Cfx96 touch real time pcr detection system, by Bio-Rad (1 mentions)
Cfx384 real time detection system, by Bio-Rad (1 mentions)
Spectramax plus 384, by Molecular Devices (1 mentions)
Spectradrop micro volume microplate, by Molecular Devices (1 mentions)
Softmax pro software, by Molecular Devices (1 mentions)
Direct zol rna kit, by Zymo Research (1 mentions)
Cfx manager software version 3, by Bio-Rad (1 mentions)
Masterpure yeast rna purification kit, by Illumina (1 mentions)
Rnaqueous micro total rna isolation kit, by Thermo Fisher Scientific (1 mentions)
Minibest agarose gel dna extraction kit ver 3, by Takara Bio (1 mentions)
Multiplex pcr assay kit, by Takara Bio (1 mentions)
Vahts library quantification kit, by Illumina (1 mentions)
Tri reagent, by Merck Group (1 mentions)
Viia 7 real time pcr system, by Thermo Fisher Scientific (1 mentions)
12 protocols using qscript flex cdna kit
1
RNA extraction and qRT-PCR analysis
2
Reverse Transcription and qPCR Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reverse transcription (RT) reactions were performed with the qScript flex cDNA kit (Quantabio) in a total reaction volume of 10 μl. One reaction contained 2 μl of template RNA, 1x buffer, mix of 0.05 μM Two-tailed RT primers, 1 μl of GSP enhancer and 0.5 μl of RT enzyme, and nuclease-free water up to 10 μl. RT reactions were incubated in a CFX 1000 thermocycler (Bio-Rad) for 45 min at 25 °C, 5 min at 85 °C and then held at 4 °C. Immediately after incubation, cDNA was diluted by addition of 50 μl nuclease-free water. Quantitative PCR (qPCR) was performed in a total volume of 10 μl. One reaction contained 1x SYBR Grandmaster Mix (Tataa Biocenter), forward and reverse primer (final concentration 0.4 μM), and 2 μl of diluted cDNA template (resulting in a final cDNA dilution of 15x). qPCR was performed in duplicates and incubated in a 384-well plate in a CFX 384 Real Time Detection System (Bio-Rad) at 95 °C for 30 s, 45 cycles of 95 °C for 5 s, and 60 °C for 15 s followed by melting-curve analysis.
3
Spectrophotometric RNA Quantification and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA concentration was determined spectrophotometrically (SpectraMax 384 Plus and SoftMax Pro Software, SpectraDrop Micro-Volume Microplate, Molecular Devices, San Jose, CA) by optical density (OD) at 260 nm using an OD260 equivalent to 40 μg/μl. Sample purity was checked using OD260/OD280 ratio with a result of 1.99 ± 0.10. Reverse-transcription to synthesize cDNA was performed with 100 ng of total RNA template using the qScript Flex cDNA Kit following manufacturer's specifications (Quantabio, Beverly, MA).
4
Quantitative PCR-based mRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
mRNA expression levels were determined by quantitative PCR (qPCR) (StepOnePlus, ThermoFisher Scientific, MA, USA) as described previously55 (link). Total RNA was extracted using Direct-zol RNA kits (R2053, Zymo Research, CA, USA). cDNA was synthesized by qScript Flex cDNA kit (95047, Quantabio, MA, USA). PCR primers were as follows: mGAPDH Forward: CATGGCCTTCCGTGTTCCTA; Reverse: CCTGCTTCACCACCTTCTTGAT. NanoLuc Forward: GTCCGTAACTCCGATCCAAAG; Reverse: GTCACTCCGTTGATGGTTACTC.
5
Wnt Pathway Activation and Sensitivity
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
As described in detail previously (19 (link)), oligo-dT and random primers were used to reverse transcribe RNA with qScript Flex cDNA kit (Quantabio) according to the manufacturer’s instructions. To investigate whether increased Wnt pathway activation led to increased sensitivity to drugs that affected the Wnt pathway, quantitative RT-PCR (qRT-PCR) was performed using gene-specific primers (Table S1 in Supplementary Material) and Sybr Green MasterMix (Life Technologies), and expression values were normalized relative to GAPDH and HPRT RNA expression.
6
Extraction and Sequencing of Oocyte RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from oocytes, blastocysts and EPCs was isolated using the ARCTURUS® PicoPure® RNA Isolation Kit (ThermoFisher Scientific), as per manufacturer's instructions. First strand cDNA synthesis was performed using the qScript Flex cDNA kit (Quantabio, MA, U.S.A), according to manufacturer's protocol. The resultant cDNA was used to amplify target genes by PCR (Primer sequences; Supplementary Table 1 ). The expression of Ddx4 was confirmed by Sanger sequencing using a previously described protocol [66 (link)].
7
Estrogen Response and Hypoxia Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
As described in detail (15 (link)), oligo-dT and random primers were used to reverse transcribe RNA with qScript Flex cDNA kit (Quantabio) according to the manufacturer's instructions. To investigate whether estrogen exposure can lead to increased expression of estrogen response genes and whether cell lines grown in 5% oxygen conditions can induce carbonic anhydrase IX (CA9), which is the most well established target of HIF, quantitative RT-PCR (qRT-PCR) was performed using gene-specific primers (Table S2 ) and Sybr Green Master Mix (Life Technologies), and expression values were normalized relative to HPRT1 RNA expression. The 2∧(–delta delta CT) method was used to analyze the relative changes in gene expression.
8
Quantitative Real-Time PCR of TRA1 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were grown to stationary phase, diluted 10-fold into YPD and grown eight hours. Cells were harvested and RNA isolated using the MasterPure Yeast RNA Purification Kit (Epicentre). cDNA was synthesized from 1 μg of RNA using the qScript Flex cDNA kit (QuantaBio). Real-time PCR was carried out using a Bio-Rad CFX Connect Real-Time PCR Detection System with PerfeCTa SYBR Green FastMix (QuantaBio). Reactions were performed in triplicate using the TRA1 primer pair Tra1 F-qPCR/Tra1 R-qPCR (Table S2). Transcript levels were normalized to U3 RNA (U3F-qPCR/U3R-qPCR). Data were analyzed using the Bio-Rad CFX Manager software, version 3.1 (Bio-Rad).
9
TCR-β CDR3 region sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Frozen CTLs were thawed, and RNA was isolated using an RNAqueous™-Micro Total RNA Isolation Kit (Life Technologies, USA). A total of 500 ng RNA of each sample was reverse transcribed into complementary DNA (cDNA) with a universal constant region primer for TCRβ (ATCTCTGCTTCTGATGGCTCA) using a qScript Flex cDNA Kit (Quantabio, USA). Multiplex PCR was then conducted to amplify the entire CDR3 region using a Multiplex PCR Assay Kit (TaKaRa, Japan) with forward primers specific to V segments and a reverse primer targeting the C region.23 (link) PCR products were loaded onto a 2.5% agarose gel (Sigma, USA). After 90 min of electrophoresis at 130 V, bands centered at 300 bp were extracted (TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.3.0). Real-time fluorescence quantitative PCR was used to quantify the absolute concentration of the purified fragment (VAHTS Library Quantification Kit for Illumina). Based on their concentrations, all libraries were pooled and subjected to sequencing using the HiSeq X Ten platform under a 150 bp paired-end strategy. About 1.5 GB data were generated for each sample, which contains about five millions of reads to ensure enough depth.
10
Quantitation of Viral RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from a duplicate of 500,000 cells infected for 72 hr using Tri-Reagent (Sigma-Aldrich). Reverse transcription was performed with qScript Flex cDNA kit (Quantabio), using either oligo-dT or random primers, as described for each sample. Real-time PCR was performed using the SYBR Green master-mix (ABI) on a real-time PCR system StepOnePlus (life technologies), with the following primers:
Technical triplicate results in CT were averaged and normalized to the U21 for sample virus and to oligo-dT cDNA for each duplicate.
Technical triplicate results in CT were averaged and normalized to the U21 for sample virus and to oligo-dT cDNA for each duplicate.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!