Afuresertib

Migration and Invasion assays were performed following the Corning Cell Migration and Invasion Quantification Assay with Acetic Acid-dependent Elution of Crystal Violet. Modifications were that SH-SY5Y cells were precultured for 24 h serum free, 2 × 10⁵ cells were added/well, and the migration assay was performed over 48 or 72 h (Fig. 2) and invasion for 3 or 5 days (Fig. 2). For SK-N-AS cells, the migration assay was performed over 24 h, and invasion for 48 h. Corning 24-well plates 8 micron were used for migration and Corning 24-well plates 8 micron coated with Matrigel for invasion assays. In some experiments, cells were incubated with the integrin complex antagonists obtustatin (α1β; R&D Systems, Minneapolis, MN; 0.5, 1 µM), cilengitide (αvβ5; R&D Systems; 1, 5 µM), and GLPG-0187 (αvβ1 and αvβ5; R&D Systems; 5, 10 nM), or the Akt inhibitor afuresertib (Selleckchem, USA; 0.1, 0.5 µM), or ERK inhibitor ravoxertinib (Selleckchem; 0.5, 1 µM). After crystal violet staining and imaging with microscopy and photgraphy, acetic acid elution and quantification were performed with a plate reader (Cell Migration and Invasion Quantification Assay with Acetic Acid-dependent Elution of Crystal Violet, Corning Life Sciences, Tewksbury, Ma).

Primary antibodies against p53, Phospho-Akt (S473), Total-Akt, PUMA, Phospho-FoxO3a (S253), Total-FoxO3a, Phospho-p65 (S536), Total-p65, Bax, Noxa, Bid, Bim, Bcl-2, Bcl-XL, Mcl-1, Cox IV, Cleaved-Caspase3, β-actin LC3, Total-MLKL, and Phospho-MLKL (Ser358) were purchased from Cell Signaling Technology. Lipofectamine™ Reagent was purchased from Invitrogen. HRP-conjugated anti-rabbit and/or anti-mouse secondary antibodies and ECL-plus kit were from GE Healthcare. Ipatasertib and 5-FU were purchased from APP Pharmaceuticals. afuresertib and perifosine were purchased from Selleck Chemicals(Houston, TX). Regofenib and cisplatin were purchased from Axon Medchem. Other chemicals were mainly from Sigma. CCK-8 kit was from 7 Sea Biotech (Shanghai, China). The plasmid of expressing PUMA was kindly supplied by Jian Yu, PhD^{9 (link)}.

Mouse-derived MPNST cell lines described previously [34 (link)] were cultured at 37 °C in a humidified atmosphere in 5% CO₂ in low pH DMEM (Thermo Fisher Scientific) supplemented with 10% FBS (Corning, lot #35070165) and 1% Penicillin Streptomycin (Thermo Fisher Scientific), unless otherwise indicated. Cell lines were verified to be free of Mycoplasma contamination every 6 months by PCR (ATCC). Human-derived MPNST cell lines were cultured as described previously [85 (link)]. Capmatinib (Novartis), trametinib (Novartis), everolimus (Selleckchem), and afuresertib (Selleckchem) solutions were prepared in DMSO. For human cell line [86 (link)] IC₅₀ experiments, drugs were purchased as 10 mM stock solutions (Selleckchem) and handled as previously described [85 (link)]. All cell culture experiments were performed 3 independent times, unless otherwise noted.

Recombinant mouse IFN‐γ and TNFα were purchased from R&D Systems (Minneapolis, MN, USA). Dex sodium phosphate was purchased from Suzhou No. 6 Pharmaceutical Factory (Suzhou, China). RU486 and LPS were from Sigma Aldrich (St. Louis, MO, USA). Purified antibodies specific for CD3 and CD28, and fluorescent labeled antibodies specific for CD45, CD3, CD4, CD8, CD25, CD69, and IFN‐γ were from eBioscience (San Diego, CA, USA). MAZ51 was purchased from Millipore (Billerica, MA, USA). LY294002 and Afuresertib were purchased from Selleck (Houston, TX, USA). EdU was purchased from Invitrogen (Carlsbad, CA, USA). Mouse Vegfc shRNA lentiviral particles and control particles were prepared by GenePharma (Shanghai, China) with the following sequences:
shRNA 1^# (LV3‐Vegfc‐mus‐637): 5′‐GCCACGTGAGGTGTGTATAGA‐3′,
shRNA 2^# (LV3‐Vegfc‐mus‐1400): 5′‐GCGAATCGACTGAAGCATTGT‐3′.

The human CML cell line K562 was obtained from the Japanese Collection of Research Bioresource Cell Bank. The human AML cell line MOLM-13 and MOLM-14 were purchased from DSMZ (German Collection of Microorganisms and Cell Cultures). Primary human AML samples from newly diagnosed patients were obtained from the sample archive at the Aichi Medical University Hospital. All samples were obtained after written informed consent, and the use of biological samples for research was approved by the ethics committee of the Aichi Medical University Hospital (Approval Number 2020-156), in accordance with the Declaration of Helsinki. The cells were cultured in RPMI-1640 supplemented with 10% fetal bovine serum (FBS) at 37 °C in a 5% CO₂ humidified atmosphere. Afuresertib, gilteritinib, and quizartinib were purchased from Selleck Chemicals (Houston, TX, USA). Sorafenib was obtained from ChemScene (Monmouth Junction, NJ, USA). Pimozide was obtained from Sigma-Aldrich (St. Louis, MO, USA). Alemtuzumab, a recombinant humanized monoclonal antibody against human CD52, was purchased from Sanofi K.K. (Tokyo, Japan).

Tumors were established from dissociated PDX and tumor harboring mice were randomized into treatment and control cohorts of 6 animals when the tumor average size reached about 100 mm³ (single Afuresertib experiment) or individually distributed into different treatment groups when tumors reached about 100 mm³ (combination experiment). For Afuresertib treatment, drug (100 or 20 mg/kg) and vehicle were administered by oral gavage 5 times a week. Afuresertib (Selleck, S7521) was dissolved in 20% PEG-400 (Lipoid), 1% DMSO and 79% H₂O. For trametinib (ApexBio, A3018) treatment, drug (0.5 mg/kg) was dissolved in 4% DMSO/ corn oil and administered by i.p. injection five times a week. Tumor size was measured three times a week using a caliper and mouse weight was measured twice a week. No mice needed to be euthanized due to severe body weight loss (>20% than baseline).