ChIP assays were carried out using the ChIP Assay kit (Abclonal, Woburn, MA, USA) according to the manufacturer’s protocol. Briefly, cells were crosslinked by formaldehyde treatment, followed by ultrasonication. Immunoprecipitation was carried out with 2 μg of anti-E2F1 antibody (Abcam, Cambridge, UK) at 4 °C overnight with rotation. The purified DNA was amplified with specific primers (see Table 1 ). The PCR products were analyzed by 1% agarose gel electrophoresis. Normal rabbit IgG was used as the negative control, and 5% input DNA was used as the positive control.
Anti e2f1 antibody
Manufactured by Abcam
Sourced in United Kingdom, United States, China
Anti-E2F1 antibody is a laboratory reagent used in research applications. It is designed to detect and bind to the E2F1 protein, a transcription factor involved in the regulation of cell cycle progression. The antibody can be used in various experimental techniques, such as Western blotting, immunohistochemistry, and immunoprecipitation, to study the expression and localization of the E2F1 protein in biological samples.
Automatically generated - may contain errors
Lab products found in correlation
Anti cyclin d1 antibody, by Abcam (2 mentions)
Cell lysis buffer, by Beyotime (2 mentions)
Horseradish peroxidase conjugated secondary antibody, by Jackson ImmunoResearch (2 mentions)
Ecl reagent, by Thermo Fisher Scientific (2 mentions)
Chip assay kit, by ABclonal (1 mentions)
Inverted fluorescence microscope, by Leica (1 mentions)
Foxo1 antibody, by Abcam (1 mentions)
Anti vegf antibody, by Proteintech (1 mentions)
Anti hif2α antibody, by Abcam (1 mentions)
Anti cyclin d1 antibody, by Cell Signaling Technology (1 mentions)
Anti β actin antibody, by Cell Signaling Technology (1 mentions)
Pierce bca protein assay kit, by Thermo Fisher Scientific (1 mentions)
Ez magna chip tma kit, by Merck Group (1 mentions)
Sybr green, by Takara Bio (1 mentions)
Anti acetyl histone h3 antibody, by Merck Group (1 mentions)
Hoechst 33258, by Merck Group (1 mentions)
Anti wnt5a antibody, by Abcam (1 mentions)
Anti beta tubulin antibody, by Abcam (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Anti β catenin antibody, by Abcam (1 mentions)
12 protocols using anti e2f1 antibody
1
ChIP Assay for E2F1 Transcription Factor
2
Immunofluorescence Visualization of E2F1 and FOXO1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were passaged until reaching 80% confluence and fixed with 4% paraformaldehyde for 15 min, washed 3 times with PBS (10 min each), permeabilized with 0.25% Triton X-100 for 10 min at room temperature, washed with 3 times PBS, and blocked with 5% BSA for 30 min. After washing with PBS, the cells were incubated at 4 °C overnight with an anti-E2F1 antibody (1:100, Abcam) and foxo1 antibody (1:50, Abcam). The cells were washed with PBS and incubated with a fluorescent-labeled secondary antibody (DyLight red 594, Abbkine, Amyjet) for 40 min in the dark and then later treated with DAPI for 10 min. Fluorescence was observed using a Leica inverted fluorescence microscope (Leica, Germany).
3
Analyzing ccRCC Cell Signaling Pathways
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ccRCC cells were lysed with NP-40 lysis buffer according to the manufacturer’s instructions. Then, the protein concentration of each sample was measured using PierceTM BCA protein assay kit (Thermo, MA, USA). Equal amounts of cell lysates were separated by SDS-polyacrylamide gel electrophoresis (PAGE) and transferred onto a polyvinylidene fluoride (PVDF) membrane. After being blocked in 5% fat-free milk, the PVDF membranes were incubated with primary antibodies overnight at 4 °C. The following antibodies were used: anti-HIF2α antibody (Catalog number: ab199, 1:1000) was purchased from abcam (Cambridge, UK); anti-E2F1 antibody (Catalog number: 3742, 1:1000), anti-Cyclin D1 antibody (Catalog number: 55506, 1:1000) and anti-Beta-actin antibody (Catalog number: 4970, 1:1000) were all purchased from Cell signaling Technology (MA, USA); anti-VEGF antibody (Catalog number: 19003-1-AP, 1:1000) was purchased from Proteintech (Wuhan, China). Then membranes were incubated with HRP-conjugated anti-rabbit IgG at room temperature for 1 h and signal detection was visualized using a western blot substrate kit (Tanon, Shanghai, China).
4
ChIP Assay for Histone Acetylation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assays were performed with the EZ-Magna ChipTM A kit (Millipore) according to the manufacturer’s instructions. A total of 1×107 Hela cells were fixed in 1% formaldehyde at room temperature for 10 min. The cell lysates were sonicated to generate 200–1,000 bp DNA fragments. Then immunoprecipitated with anti-IgG antibody (Millipore), anti-E2F1 antibody (Abcam) and anti-acetyl histone H3 antibody (Millipore). After reverse cross-linking and DNA purification, DNA from input or immunoprecipitated samples were assayed by qRT-PCR using SYBR Green (Takara) with the following primer: 5ʹ-GGGCTTCAATGGGTCAAGG-3ʹ (sense); 5ʹ-GCCTTCGGTGTATTTCCCTG-3ʹ (antisense).
5
Signaling Pathways in Neuronal Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Amyloid β peptide (1–42; Human Aβ42; Abcam plc., #ab120301), Hoechst 33258 (Sigma-Aldrich, #B2883), recombinant mouse Wnt5a protein (Bio-Techne China Co. Ltd. R&D Systems #645-WN), Roscovitine (ROS; Selleck.cn, #S1153), KN62 (Selleck.cn, #S7422), Calmodulin Kinase IINtide, Myristoylated (Ntide; Merck Millipore, #208921) and Z-VAD-FMK (Selleck.cn, #S7023) were added to the media at the indicated concentrations and time points. For transient gene transfection, DIC5 cortical neurons were transfected using the calcium phosphate transfection method described previously (Kingston et al., 2003 (link)). Lipofectamine 3000 (Thermo Fisher Scientific Inc.) was used for transient gene or siRNA transfection of HEK293 cells.
The following primary antibodies were used: Anti-Wnt7a antibody (Abcam plc., #ab100792), Anti-Wnt5a antibody (Abcam plc., #ab72583), Anti-beta Tubulin antibody (Abcam plc., #ab6046), Anti-Cyclin D1 antibody (Abcam plc., #ab16663), Anti-E2F1 antibody (Abcam plc., #ab94888), phospho-Rb (Ser795) antibody (Cell Signaling Technology, Inc., #9301), Anti-β-Catenin antibody (Abcam plc., #ab32572), Anti-Histone H1 antibody (Abcam plc., #ab71594), Anti-phospho-CaMKII alpha (Thr286)/beta (Thr287; Abcam plc., #ab32678), Flag (Sigma-Aldrich, #F1804).
The following primary antibodies were used: Anti-Wnt7a antibody (Abcam plc., #ab100792), Anti-Wnt5a antibody (Abcam plc., #ab72583), Anti-beta Tubulin antibody (Abcam plc., #ab6046), Anti-Cyclin D1 antibody (Abcam plc., #ab16663), Anti-E2F1 antibody (Abcam plc., #ab94888), phospho-Rb (Ser795) antibody (Cell Signaling Technology, Inc., #9301), Anti-β-Catenin antibody (Abcam plc., #ab32572), Anti-Histone H1 antibody (Abcam plc., #ab71594), Anti-phospho-CaMKII alpha (Thr286)/beta (Thr287; Abcam plc., #ab32678), Flag (Sigma-Aldrich, #F1804).
6
ChIP-qPCR for Protein-DNA Interactions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The crosslinking reaction was terminated by glycine in cells treated with 1% formaldehyde. Next, the resultant DNA-protein complex was sonicated to produce 200–1000 bp DNA fragments. The anti-E2F1 antibody (Abcam, Burlingame, CA, USA) was added to form the antibody-target protein-DNA complex and protein A-Sepharose beads were used to immunoprecipitate complex. After washing and reversing the cross-links, the enriched DNA was purified and then examined by qRT-PCR. The primer sequences were listed in Additional file 1 : Table S2.
7
Protein Expression Analysis in RA FLS
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total protein was extracted from RA FLS. A BCA kit (Beyotime) was used for evaluating the total protein concentration. Protein samples were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto PVDF membranes (Millipore). After blocking, the membranes were probed with primary antibodies and then incubated with specific horseradish peroxidase-conjugated secondary antibodies (Bio-Rad). Immunodetection was performed using an enhanced chemiluminescence kit (Thermo Fisher Scientific). GAPDH was used as a loading control for internal correction. The primary antibodies included an anti-proliferating cell nuclear antigen (PCNA) antibody (Abcam), an anti-cyclin D1 antibody (Abcam), an anti-IL-1 antibody (Abcam), an anti-IL-6 antibody (Abcam), an anti-MMP-3 antibody (Abcam), an anti-p53 antibody (Abcam), an anti-E2F1 antibody (Abcam), anti-ErbB1/2 antibodies (Abcam), and a GAPDH antibody (Sigma). The bands were exposed under x-ray using Gel Imager (Bio-Rad) (17 (link)).
8
E2F1 Chromatin Immunoprecipitation Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assays were performed using ChIP assay kit (Millipore, Massachusetts, USA) according to the manufacturer’s instructions. Soluble chromatin was prepared from MKN-45 cells and incubated with an anti-E2F1 antibody (Abcam, UK) or human IgG (negative control). The primers were as follows: for site 1, forward: CAGTCTCATTCTGTCGCCCA, reverse: GCCTGGCCAACATGAAGAAA; site 2, forward: GGGTTTCATCATGTTGGCCA, reverse: GGAAAGGTTTGATTGTTTGCTTG; site 3, forward: AGGCCGGAATAACACACAGA, reverse: ATGTCCTCCAGATGCATGTG; site 4, forward: TCCCAGTTCTACCACGTACT, reverse: ATACACAGGCACAGAAAGGTT.
9
Western Blot Analysis of CDK2 and E2F1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total protein of the cells was extracted with RIPA lysis
buffer (Beyotime, China), with the protein concentration
determined by the BCA method. After denaturation, the
protein samples were loaded into each well (20 μg per lane),
separated by SDS-PAGE and electrically transferred to
the polyvinylidene fluoride (PVDF) membrane. After that,
the membrane was blocked with tris buffered saline with
tween 20 (TBST) solution containing 5% skimmed milk
at ambient temperature for 1 hour. The PVDF membrane
was then incubated with the primary antibodies including
anti-CDK2 antibody (1:1000), anti-E2F1 antibody (1:1000)
and anti-GAPDH antibody (1:1000, all from Abcam, China)
overnight at 4˚C, followed by washing in TBST for 4 times,
each time for 8 minutes. Next, the PVDF membrane was
incubated with the corresponding secondary goat antirabbit antibody (1:2000, Abcam, China) for 1.5 hours at
room temperature, followed by rinsing with TBST 4 times,
each time for 8 minutes. Ultimately, X-ray imaging was
performed with ECL Western blot Substrate kit (ThermoFisher Scientific, USA) to show the protein bands.
buffer (Beyotime, China), with the protein concentration
determined by the BCA method. After denaturation, the
protein samples were loaded into each well (20 μg per lane),
separated by SDS-PAGE and electrically transferred to
the polyvinylidene fluoride (PVDF) membrane. After that,
the membrane was blocked with tris buffered saline with
tween 20 (TBST) solution containing 5% skimmed milk
at ambient temperature for 1 hour. The PVDF membrane
was then incubated with the primary antibodies including
anti-CDK2 antibody (1:1000), anti-E2F1 antibody (1:1000)
and anti-GAPDH antibody (1:1000, all from Abcam, China)
overnight at 4˚C, followed by washing in TBST for 4 times,
each time for 8 minutes. Next, the PVDF membrane was
incubated with the corresponding secondary goat antirabbit antibody (1:2000, Abcam, China) for 1.5 hours at
room temperature, followed by rinsing with TBST 4 times,
each time for 8 minutes. Ultimately, X-ray imaging was
performed with ECL Western blot Substrate kit (ThermoFisher Scientific, USA) to show the protein bands.
10
ChIP-qPCR analysis of E2F1 binding to CDK2 promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Briefly, BEL-7402 and Hep3B cells were fixed with
formaldehyde for 10 minutes. The ultrasonic breaker was
set to 10 seconds per ultrasonic cycle with 10-second
intervals with 15 cycles to break the chromatin. The
product was centrifuged at 12000 g at 4˚C for 10 minutes.
The supernatant was collected and divided into two test
tubes, which were incubated with mouse IgG (1:100,
Abcam, China) or anti-E2F1 antibody (2 µg/ml of cell
lysate, Abcam, China) at 4˚C for overnight. Then, DNAprotein complex was precipitated by Protein Agarose/
Sepharose. Subsequently, the cross-linking was reversed
overnight at 65˚C and DNA fragments were extracted
by phenol/chloroform method. Next, qRT-PCR was
conducted to amplify CDK2 sequence with the CDK2-
specific primers and determine E2F1 binding to the CDK2promoter region.
formaldehyde for 10 minutes. The ultrasonic breaker was
set to 10 seconds per ultrasonic cycle with 10-second
intervals with 15 cycles to break the chromatin. The
product was centrifuged at 12000 g at 4˚C for 10 minutes.
The supernatant was collected and divided into two test
tubes, which were incubated with mouse IgG (1:100,
Abcam, China) or anti-E2F1 antibody (2 µg/ml of cell
lysate, Abcam, China) at 4˚C for overnight. Then, DNAprotein complex was precipitated by Protein Agarose/
Sepharose. Subsequently, the cross-linking was reversed
overnight at 65˚C and DNA fragments were extracted
by phenol/chloroform method. Next, qRT-PCR was
conducted to amplify CDK2 sequence with the CDK2-
specific primers and determine E2F1 binding to the CDK2promoter region.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!