Mission library

The knockdown cell lines Tks5-KD and -KD2, E-cadherin-KD1 and -KD2, and the knockdown control cell lines Tks5-CTL, Ecad-CTL and MDA-MB-231-mScarlet-CTL were generated by transduction of the 4T1-mScarlet, 4T1 and MDA-MB-231-mScarlet cell lines, respectively, with lentiviral particles (3 viral particles/cell) containing shRNA targeting mTks5 (Clone ID: TRCN0000105733, CGTGGTGGTGTCCAACTATAA; Clone ID: TRCN0000105734, CCTCATACATTGACAAGCGCA), hTks5 described previously^{13 (link)}, or E-cadherin (KD) (Clone ID: TRCN0000042581, CCGAGAGAGTTACCCTACATA; Clone ID: TRCN0000042579, CGGGACAATGTGTATTACTAT) or non-targeting shRNA (CTL) in the pLKO.1-puro vector (MISSION library, Sigma-Aldrich), and selection with 2 µg/mL puromycin 3-7 days after infection. Western blots were analyzed to confirm KD efficiencies. In addition, images of Ecad-CTL and Ecad-KDs immunolabeled with E-cadherin and segmented using Cellpose. Masks were overlaid on the image and integral density per cell was quantified.

C1498 is a murine myeloid leukemia cell line that developed spontaneously in a B6 mouse. C1498FF is a stable transfectant of C1498 that expresses firefly luciferase (a gift from Bruce Blazar, University of Minnesota, Minneapolis, Minnesota, USA), used to assess in vivo cell proliferation. C1498FF cells were engineered to stably express mouse PD-1H using transduction with lentivirus (pLenti) expressing full-length mouse PD-1H (C1498FF–PD-1H FL) or PD-1H with deletion of its intracellular domain (C1498FF–PD-1HΔ) or with mock lentivirus (C1498FF-mock). WEHI3 is a murine myeloid leukemia cell line that originated from a BALB/c mouse (purchased from ATCC). WEHI3 cells constitutively express PD-1H. WEHI3 cells were engineered for knockdown or KO of PD-1H expression using shRNA targeting the PD-1H transcript (MISSION Library, Sigma-Aldrich) or CRISPR-Cas9 technologies (gRNA with Cas9 protein), respectively. HL-60 and K562 cells are human myeloid leukemia cell lines not expressing PD-1H. HL-60 or K562 cells were engineered to stably express human PD-1H using transduction with lentivirus expressing full-length human PD-1H (HL-60–PD-1H or K562–PD-1H) or a mock lentivirus (HL-60–mock or K562-mock). MOLM14 and THP1 cells are human monocytic leukemia cell lines expressing PD-1H (gift of Martin Carroll, University of Pennsylvania, Philadelphia, Pennsylvania, USA).

Three different shRNAs to MKK4 were generated using the MISSION library (Sigma, USA) and a lentiviral system consisting of pRSV, pMDL, and pVSV-G. Briefly, the virus was produced by transfection of HEK293 cells with the transfer and packaging vectors using FuGENE6 (Promega, WI, USA). At 24 and 48 h.p.i., the virus-containing supernatant was filtered using a 0.45-µm nylon membrane filter and stored at −80 °C. Pooled virus preparations were used for CV-1 target cell transduction. At about 24 h.p.i., puromycin treatment was started and maintained until the end of experiments. MKK4 knockdown was verified by qPCR.
The following MKK4 shRNAs were used in this study:
A12: TRCN0000001390
(CCGGCTTCTTATGGATTTGGATGTACTCGAGTACATCCAAATCCATAAGAAGTTTTT)
B1: TRCN0000001391
(CCGGGATGTATGAAGAACGTGCCGTCTCGAGACGGCACGTTCTTCATACATCTTTTT)
B3: TRCN0000001393
(CCGGGATATGATGTCCGCTCTGATGCTCGAGCATCAGAGCGGACATCATATCTTTTT)
Scrambled shRNA: SHC002
(CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTT)

Four different shRNA constructs targeting human QKI were obtained from the Mission Library (Sigma Aldrich) and tested for their efficiency to knock down QKI. The best shRNA was selected to perform all experiments. As a control, a non-targeting shRNA was used. The human KLF2 overexpression construct was kindly provided by Prof. A. Horrevoets, VU University Medical Center, Amsterdam, the Netherlands. Lentiviral particles were produced as described by the Sigma Library protocol using HEK293T cells. Lentiviral transductions of HUVECs were done with cell passage 1 or 2. Lentiviral particles were incubated overnight and puromycin selection (0.5 μg/ml) for 24 hours was started 24 hours after lentiviral transduction.

To obtain a knockdown or overexpression of PLXNA4, endothelial cells were transduced with lentiviral particles. Knockdown of PLXNA4 was performed in HUVECs and was achieved by transduction with virus particles encoding a shRNA against the coding region of PLXNA4 (Mission library Sigma-Aldrich, TRCN0000078686). As a control, cells were transduced with lentiviral particles encoding a scrambled shRNA. Selection of transduced cells was achieved using puromycin (2 μg/mL).
A vector encoding the PLXNA4 gene was kindly provided by Prof. G. Neufeld. Due to low transduction efficiency in primary endothelial cells (caused by the large size of the PLXNA4 vector), overexpression of PLXNA4 was performed in the immortalized endothelial cell line ECRF. Transduced cells were selected using blasticidin (50 μg/mL). As a control, cells were transduced with a mock virus and selected with puromycin.