Ezol reagent

Total RNA from cultured cells of different groups was obtained by Ezol reagent (GenePharma, China), and purified via column passing method. Reverse transcription and quantitative real-time PCR (qPCR) were conducted via Hairpin-it™ microRNA and U6 snRNA Normalization RT-PCR Quantitation Kit (GenePharma, China) according to the manufacturer's instructions. The primer sequences for RT-qPCR were as follows: HmiR-22-3p-FO-2: 5′-3′GCGGTCAAGCTGCCAGTT and HmiR-22-3p-RE-2: 5′-3′TATGGTTGTTCACGACTCCTTCAC. U6 forward: 5′-3′CGCTTCGGCAGCACATATAC and reverse: 5′-3′TTCACGAATTTGCGTGTCATC.

Total RNA of PC-3 cells transfected with different RNA oligonucleotides was extracted using Ezol reagent (Genepharma), according to the manufacturer's instruction. The cDNA synthesis and real-time PCR were performed using Real-time Fluorescence Quantitative General Reagents (Genepharma), following manufacturer's instructions. The primers used for PCR were MCT4 (forward) 5'-GATGCGACCCACGTCTACAT-3', and (reverse) 5'-GTTGCCCAGCAGCAAAATCA-3', as well as GAPDH (forward) 5'-TCTCTGCTCCTCCTGTTCGA-3' and (reverse) 5'-GCGCCCAATACGACCAATC-3'. MCT4 mRNA expression levels were calculated by relative quantification (2^-ΔΔCt) method. Experiments were performed in triplicate.

We extracted total RNA from each HCC specimen and paired paracancerous liver tissue using Ezol Reagent (Genepharma, Shanghai, China) according to the manufacturer's instructions. The purity and quality of total RNA was assessed using the NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA). We synthesized the target cDNA by reverse transcription (RT) using random primers and the GoScript RT System (Promega, Madison, WI, USA). A non-template reaction was served as the control. The GoTaq qPCR Master Mix (Promega) and the qRT-PCR Plus System (Stratagene, La Jolla, CA, USA) were used for the real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR). Primers for hsa_circ_0001306 and glyceraldehyde 3-phosphate dehydrogenase (G3PDH) were synthesized by GenePharma (Shanghai, China). To validate the hsa_circ_0001306 was circular, the extracted total RNA was incubated at 37℃ with or without RnaseR (3U/ug) for 30 minutes to digest the linear RNA. The hsa_circ_0001306 expression level was then detected with its specific primers. The sequences of G3PDH, hsa_circ_0001306, miR-527, U6, and FBXW7 primers were in Supplementary File 3.