Fla 7000 image analyzer

We added another group, (G) nontreated control mice, to this evaluation.
On day 28, we diluted 2-¹⁴C-thymidine (0.185 MBq) in 0.2 ml of isotonic saline and administrated it at a dose of 0.2 ml to the CRD model control group (D), 25 mg/kg administered group (E), 100 mg/kg administered group (F), and nontreated control group (G). Mice were sacrificed 1 h after the tail vein injection of 2-¹⁴C-thymidine and then rapidly frozen in dry ice and acetone. We removed the hind leg surgically from the hip joint using clippers and exposed the femur and tibia. Mice from which the hind legs were removed were embedded in carboxymethylcellulose gel. Twenty micrometer-thick serial sections were made through the sagittal plane of each mouse with the tape-sectioning method using a Cryo Polycut cryostat (Reichert-Jung, Nussloch, Germany) at −20°C. Sections on adhesive tape (Yu-Ki Ban, Nitto Medical Co., Ltd., Osaka, Japan) were desiccated and placed on a BAS-MS2040 imaging plate (Fujifilm Co., Ltd, Tokyo, Japan) for 1 day. Whole-body macroautoradiographs were processed digitally with an FLA7000 image analyzer (Fujifilm Co., Ltd).

5′-³²P-labeled RNA (3000 cpm/μl) was incubated with PARN in buffer comprising 20 mM Tris-HCl (pH 7.5), 50 mM KCl, 2.5 mM MgCl₂, 50 μg/ml BSA, 1 U/μl SUPERase-IN (Ambion) and 250 nM non-labeled miR-21 (for Figure 5, Supplementary Figure S7). A portion of each sample was separated on a 20% denaturing acrylamide gel, and the radioactivity was visualized using a FLA7000 Image Analyzer (Fujifilm). The concentrations of His-PARN were 690 pM for Figures 1d and 6a, 40.8 pM for Supplementary Figure S3, and 10.2 pM for Figure 5a–d and Supplementary Figure S7a–c. The concentrations of CUGBP1-Flag were 9.6 nM for Figure 5a, 0–9.6 nM for Figure 5b and 4.8 nM for Figure 5c, d and Supplementary Figure S7.

5′-³²P-labeled miRNAs (40 nM) were mixed with different concentrations of CUGBP1-Flag (1.25–1280 nM) in a mixture containing 20 mM HEPES-KOH (pH 7.6), 100 mM KCl, 2 mM MgCl₂, 8% glycerol and RNasin ribonuclease inhibitor (Promega). The mixture was incubated at 30°C for 30 min. After adding a 25% volume of loading dye [50 mM Tris-HCl (pH 8.0) and 5 mM Mg(OAc)₂], each sample was analyzed by 5% native PAGE at 4°C and visualized using an FLA7000 Image Analyzer (Fujifilm).
Other methods are described in the Supplementary Information.

Electrophoretic mobility shift assays on polyacrylamide gels were performed, as described previously (27 (link)). The 49-mer oligonucleotide containing the (6–4)PP, d(AGCTACCATGCCTGCTGCACGAAT(6–4)TAAGCAATTCGTAATCATGGTCATAGCT), where T(6–4)T represents the (6–4)PP formed between two thymidines, was treated with T4 polynucleotide kinase (Takara-Bio, Japan) in the presence of ³²P-ATP (∼400 kBq, Perkin Elmer), at 37°C for 30 min. The ³²P-labeled oligonucleotide was passed through a G-25 Microspin column (GE Healthcare), and was hybridized to a complementary strand, d(AGCTATGACCATGATTACGAATTGCTTAATTCGTGCAGCAGGCATGGTAGCT). The duplex was incubated at 4°C with the enzymes, in a buffer containing 50 mM Tris–HCl (pH 8.0), 50 mM NaCl and 5% glycerol, for 30 min under the yellow light, and the samples were subjected to electrophoresis on a 5% polyacrylamide gel. The dried gels were visualized with an FLA-7000 image analyzer (Fuji-Film, Japan), and the bound and unbound fractions were quantified by the MultiGauge software. The experiments were performed in triplicate, and the averaged bound concentrations were plotted over the enzyme concentrations. The dissociation constants were obtained by fitting the data with a single binding site model.