Fastfire qpcr premix probe

All available FljB and/or FliC genes from S. Abortusequi, other Salmonella serovars (groups A to F), and other members of Enterobacterales were aligned using the Megalign software (DNAStar, USA). The specific primers and probe were designed for S. Abortusequi using the Primer 5.0 software (Bio Tools, USA) (Fig. 1). The sequences of the primers and probe for the S. Abortusequi FljB gene were as follows: FljB-F, 5′-CATTAGGCAACCCGACAGTA-3′; FljB-R, 5′-GGTAGCACCGAATGATACAGC-3′; FljB-P, 5′–6-carboxyfluorescein–ACTGTAAGTGGTTATACCGATGC–MGB–3′. Real-time PCR tests were carried out in 20-μL reaction mixtures using FastFire qPCR premix probe (Tiangen, China). Briefly, reaction mixtures comprised 10 μL 2× FastFire qPCR premix, 0.6 μL of each primer (10 μM), 0.4 μL of probe (10 μM), 2 μL of bacterial DNA, and 6.4 μL of double-distilled water (ddH₂O). The amplification was performed on a QuantStudio 5 system (Thermo Fisher Scientific, USA). The cycling parameters were 95°C for 1 min, followed by 40 cycles of 95°C for 5 s and 60°C for 15 s. The S. Abortusequi-positive samples identified with the real-time PCR assay were confirmed by sequencing, a process which will not be included in routine detection.

Total viral RNA from cell culture supernatants was extracted by using the EasyPure® Viral DNA/RNA Kit (TransGen, Cat No. ER201-01 Beijing, China) according to the manufacturer’s instructions. Reverse transcription was performed to produce complementary DNA (cDNA) using Hifair II 1st Strand cDNA Synthesis Kit (Yeasen Biotech, Cat No. 11123ES60, Shanghai, China), and then 2 μL cDNA was used as template for subsequent qPCR. The target N gene of GX_P2V(short_3UTR) was amplified by qPCR using FastFire qPCR PreMix (Probe) (TIANGEN, Cat No. FP208-02, Beijing, China) according to the manufacturer’s instructions. Sequences of qRT-PCR primers are as follow: P2VF, TCTTCCTGCTGCAGATTTGGAT; P2VR, ATTCTGCACAAG-AGTAGACTATGTATCGT; and Probe, FAM-TGCAGACCACACAAGGCAGATGG-GC-TAMRA. In addition, a standard plasmid was constructed through inserting a fragment amplified using P2VF and P2VR into a cloning vector pEASY-T1 (TransGen, Cat No. CT101-01 Beijing, China). Plasmids in a range of 10²–10⁸ DNA copies were used as template to generate a standard curve.