The largest database of trusted experimental protocols

Abi q6 fast real time pcr system

Manufactured by Thermo Fisher Scientific
Sourced in United States

The ABI Q6 Fast real-time PCR system is a laboratory equipment designed for the amplification and detection of nucleic acid sequences in real-time. It is capable of performing fast thermal cycling for efficient and rapid DNA/RNA quantification.

Automatically generated - may contain errors

2 protocols using abi q6 fast real time pcr system

1

Quantitative Analysis of Inflammatory Markers in Colon Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from colon cancer lines using Trizol reagent (Magen, R4801-02, Shanghai, China) and 1 µg of total RNA was reverse transcribed using the PrimeScript RT reagent kit (Vazyme, Nanjing, China) to detect relevant mRNAs. Real-time fluorescence quantitative PCR was performed using SYBR Premix Ex Taq II (Vazyme, Nanjing, China) at 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, 55 °C for 30 s, and 72 °C for 30 s. The primer sequences used for PCR are shown in Table 1. Changes in relative expression of different samples were calculated by the ABI Q6 Fast real-time PCR system (Applied Biosystems, Foster City, CA, USA) using the 2−∆∆CT method. GAPDH was used as an internal reference gene.

Primer sequences used for qRT-PCR analyses

GenePrimerSequence
Mouse GAPDHm-GAPDH-FCCAGAGCTGAACGGGAAGCTCAC
m-GAPDH-RCCATGTAGGCCATGAGGTCCACC
Mouse CXCL1m-CXCL1-FAGCTGCGCTGTCAGTGCC
mCXCL1-RCAAGCCTCGCGACCATTC
Mouse IL-6m-IL6-FCTCCCAACAGACCTGTCTATAC
m-IL6-RCCATTGCACAACTCTTTTCTCA
Mouse IL-1βm-IL1β-FAAATGCCACCTTTTGACAGTGA
m-IL1β-RGGTTTGGAAGCAGCCCTTCA
Mouse TNF-αm-TNFα-FGATCGGTCCCCAAAGGGATG
m-TNFα-RCCACTTGGTGGTTTGTGAGTG
Mouse P300m-P300-FGCCAACATTGGAGGCACTTT
m-P300-RGCCAACATTGGAGGCACTTT
+ Open protocol
+ Expand
2

Quantitative RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from samples by RNAiso Plus (TaKaRa, Cat. No. 9108) according to the manufacturer’s instructions. mRNA expression levels were quantified by quantitative real-time RT-PCR. The reverse transcription reaction was performed using 1 μg of total RNA with a HiScript II 1st Strand cDNA Synthesis Kit ( + gDNA wiper; Vazyme, Cat. No. R212). Quantitative real-time PCR was performed using ChamQ SYBR Color qPCR Master Mix (High ROX Premixed; Vazyme, Cat. No. Q441) at 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, 55 °C for 30 s, and 72 °C for 30 s. PCR was performed on an ABI Q6 Fast Real-time PCR system (Applied Biosystems, Foster City, CA, USA), and changes in expression were calculated using the 2-∆∆Ct method. Primers are listed in Table S2.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!