High sensitive troponin T (hs-TnT) was measured with an electrochemiluminescence immunoassay (ultrasensitive troponin T method, ref 05092744 190; Roche Diagnostics) performed on a cobas e601 analyzer (Roche Diagnostics). The analytic performance of this assay has been validated [15 (link)]. As described by the manufacturer (ref 05092744 190; Roche Diagnostics), the 99th percentile for normal was 14 ng/L and the functional sensitivity (limit of quantification with a coefficient of variation of < 10%) was 13 ng/L. NT-proBNP levels were determined using an immuno-electrochemiluminescence assay and the Modular Analytics E170 (Roche Diagnostics Inc., Indianapolis, IN). This assay has < 0.001% cross-reactivity with bioactive BNP, and the assay had inter-run coefficients of variation ranging from 0.9 to 5.5%. Immunoassays for Stanniocalcin-2, PAPP-A, and intact IGFBP-4 were from AnshLabs, Webster, TX, USA. Stanniocalcin-2 levels were measured using an enzyme linked immunosorbent assay (AL-143) with a limit of detection of 0.033 ng/mL; PAPP-A was measured with an enzyme linked immunosorbent assay (picoPAPP-A, AL-101), and as described by the manufacturer the limit of detection is 0.037 ng/mL; intact IGFBP-4 was measured with an enzyme linked immunosorbent assay (AL-124) with a limit of detection of 0.669 ng/mL.
Papp a
Manufactured by Ansh Labs
Sourced in United States
PAPP-A is a laboratory equipment product manufactured by Ansh Labs. It is used to measure the level of Pregnancy-Associated Plasma Protein-A, a substance found in the blood during pregnancy. The core function of PAPP-A is to facilitate the quantitative analysis of this protein for clinical diagnostic purposes.
Automatically generated - may contain errors
2 protocols using papp a
1
Cardiac Biomarkers Measurement Protocols
2
Comprehensive ELISA and Sequencing Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ELISA was used to determine serum levels of ALS and insulin (BioVendor), IGF1, free IGF1, IGF2, total IGFBP4, and IGFBP5, intact IGFBP3 and IGFBP4, PAPP-A and PAPP-A2 (Ansh Labs, Webster). GH and total IGFBP-3 were measured by chemiluminiscence immunoassays (DiaSorin). All assays were performed according to the manufacturers' instructions and all intra-and inter-assay coefficients of variation were lower than 10%.
Whole-genome sequencing was performed in blood DNA from the index case by CENTOGENE. DNA sequencing and validations were performed by CAP/CLIA, commercially accredited laboratories. The average coverage depth was $30X. A complete illustration of the pipeline, filtration processes, and prioritization steps have been previously published https://pubmed.ncbi.nlm.nih.gov/30202406/. The variant plus 150 bp on either side of each variant in the genomic region were amplified using specific primers PAPPA2 c.2656 FWD, ACTCTCCTCATCTCCCATCTC. PAPPA2 c.2656 REV CAGTGGTCACCAGGGTATAAAG, and bidirectionally sequenced using Sanger sequencing.
Whole-genome sequencing was performed in blood DNA from the index case by CENTOGENE. DNA sequencing and validations were performed by CAP/CLIA, commercially accredited laboratories. The average coverage depth was $30X. A complete illustration of the pipeline, filtration processes, and prioritization steps have been previously published https://pubmed.ncbi.nlm.nih.gov/30202406/. The variant plus 150 bp on either side of each variant in the genomic region were amplified using specific primers PAPPA2 c.2656 FWD, ACTCTCCTCATCTCCCATCTC. PAPPA2 c.2656 REV CAGTGGTCACCAGGGTATAAAG, and bidirectionally sequenced using Sanger sequencing.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!