The largest database of trusted experimental protocols

Magna pure lc mrna isolation kit

Manufactured by Roche

The MagNA Pure LC mRNA Isolation Kit is a laboratory equipment product designed for the isolation and purification of messenger RNA (mRNA) from various sample types. The kit utilizes magnetic bead-based technology to capture and extract mRNA molecules from the sample, enabling efficient and reproducible purification for downstream applications.

Automatically generated - may contain errors

2 protocols using magna pure lc mrna isolation kit

1

Cytokine and Neuropeptide Analysis in Pediatric Blood

Check if the same lab product or an alternative is used in the 5 most similar protocols
Venous blood was taken with parents agreement after clinical examination of the children in the study center. The heparin blood for the determination of cytokines and neuropeptides was processed after a maximum of 4 hours storage at room temperature; the blood samples were stored at –80 °C until further analysis was carried out. The neuropeptides VIP, SOM and SP were determined using ELISA (Phoenix Europe, Karlsruhe, Germany) and the cytokines (IFN-γ, IL-4, IL-5 and IL-9) using cytometric bead array (CBA, BD Bioscience, Heidelberg, Germany) according to the manufacturers instructions and as described by Herberth and colleagues [14 (link)].
The transcription factors (GATA3, Tbet, FOXP3) and the regulatory factors (SOCS1, SOCS3) were determined after RNA extraction from 1 ml of heparinized blood (MagNA Pure LC System and MagNA Pure LC mRNA Isolation Kit, Roche Applied Science, Mannheim, Germany) using real-time PCR (Lightcycler, LC search Primer Kits, Roche Applied Science, Mannheim, Germany) as described by Herberth and colleagues [14 (link)].
+ Open protocol
+ Expand
2

Quantifying mRNA Levels in moDCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
mRNA content of 2 × 105 moDCs was isolated with the MagNA Pure LC mRNA isolation kit (Roche) on the MagNA pure instrument (Roche Applied Science) following manufacturer’s indications. TNF, IL-6, IL-8, and IL-1β mRNAs were quantified by real-time PCR using TaqMan RNA Amplification Kit (Roche) or LightCycler Multiplex RNA Virus Master (Roche) on a LightCycler 480 instrument (Roche Applied Science). Primers and probes were synthesized by Eurogentec (Actb: F: ggatgcagaaggagatcactg, R: cgatccacacggagtacttg, probe: ccctggcacccagcacaatg; Ctsb: F: tcccaccatcaaagagatca, R: atgcagatccggtcagagat, probe: tgtggctcctgctgggcctt; Syk: F: cagggaatatgtgaagcagaca, R: tccagctgaggcttctgact, probe tcaggctctggagcaggcca; IL1b: F: acagatgaagtgctccttcca, R: gtcggagattcgtagctggat, probe: ctctgccctctggatggcgg; IL6: F: gacagccactcacctcttca, R: agtgcctctttgctgctttc, probe: cctcgacggcatctcagccc; CXCL8/IL8: F: gccttcctgatttctgcagc, R: actgacatctaagttctttagcactcc, probe: tggcaaaactgcaccttcacacag, TNF: F: cccagggacctctctctaatc, R: atgggctacaggcttgtcact, probe: tggcccaggcagtcagatcatc). mRNA levels were normalized to β-actin mRNA expression.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!